Incidental Mutation 'R0362:Fbn1'
ID36210
Institutional Source Beutler Lab
Gene Symbol Fbn1
Ensembl Gene ENSMUSG00000027204
Gene Namefibrillin 1
SynonymsFib-1
MMRRC Submission 038568-MU
Accession Numbers

Genbank: NM_007993; MGI: 95489

Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R0362 (G1)
Quality Score124
Status Validated
Chromosome2
Chromosomal Location125300594-125507993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125309777 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 2519 (Q2519R)
Ref Sequence ENSEMBL: ENSMUSP00000099524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028633] [ENSMUST00000103234]
Predicted Effect probably damaging
Transcript: ENSMUST00000028633
AA Change: Q2519R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028633
Gene: ENSMUSG00000027204
AA Change: Q2519R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
EGF 118 146 8.52e0 SMART
EGF 149 178 5.4e-2 SMART
Pfam:TB 193 235 6.9e-17 PFAM
EGF_CA 246 287 3.56e-11 SMART
EGF_CA 288 329 9.39e-11 SMART
Pfam:TB 343 388 2.3e-17 PFAM
low complexity region 394 445 N/A INTRINSIC
EGF 454 491 8.57e-5 SMART
EGF_CA 492 531 9.39e-11 SMART
EGF_CA 532 573 2.38e-12 SMART
EGF_CA 574 614 5.48e-12 SMART
EGF_CA 615 655 5.39e-11 SMART
Pfam:TB 670 712 1.4e-17 PFAM
EGF_CA 725 766 1.53e-10 SMART
EGF_CA 767 808 2.42e-13 SMART
EGF_CA 809 848 2.44e-9 SMART
Pfam:TB 862 902 2.1e-14 PFAM
EGF_CA 912 953 3.32e-11 SMART
Pfam:TB 967 1009 3.9e-17 PFAM
EGF_CA 1030 1071 5.11e-12 SMART
EGF_CA 1072 1114 5.39e-11 SMART
EGF_CA 1115 1156 1.55e-11 SMART
EGF_CA 1157 1198 5.48e-12 SMART
EGF_CA 1199 1239 5.61e-9 SMART
EGF_CA 1240 1281 1.22e-9 SMART
EGF_CA 1282 1323 2.62e-9 SMART
EGF_CA 1324 1364 3.27e-10 SMART
EGF_CA 1365 1405 4.7e-11 SMART
EGF_CA 1406 1447 1.91e-11 SMART
EGF_CA 1448 1488 1.98e-9 SMART
EGF_CA 1489 1529 2.13e-9 SMART
Pfam:TB 1549 1590 3.5e-18 PFAM
EGF_CA 1608 1649 2.19e-11 SMART
EGF_CA 1650 1690 3.97e-9 SMART
Pfam:TB 1706 1749 9.7e-18 PFAM
EGF_CA 1768 1809 5.11e-12 SMART
EGF_CA 1810 1850 1.1e-11 SMART
EGF_CA 1851 1892 5.69e-10 SMART
EGF_CA 1893 1931 6.1e-10 SMART
EGF_CA 1932 1974 2.11e-13 SMART
EGF_CA 1975 2014 7.23e-12 SMART
EGF_CA 2015 2056 3.15e-12 SMART
Pfam:TB 2070 2112 3.7e-17 PFAM
EGF_CA 2129 2167 1.24e-10 SMART
EGF_CA 2168 2207 3.81e-11 SMART
EGF_CA 2208 2248 3.81e-11 SMART
EGF 2252 2292 5.24e0 SMART
EGF_CA 2293 2334 9.91e-10 SMART
Pfam:TB 2348 2391 8.5e-18 PFAM
EGF_CA 2404 2445 1.26e-11 SMART
EGF_CA 2446 2486 1.06e-9 SMART
EGF_CA 2487 2525 3.1e-11 SMART
EGF_CA 2526 2568 1.48e-8 SMART
EGF_CA 2569 2608 1.14e-9 SMART
EGF_CA 2609 2649 3.97e-9 SMART
EGF_CA 2650 2689 1.98e-9 SMART
low complexity region 2691 2698 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103234
AA Change: Q2519R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099524
Gene: ENSMUSG00000027204
AA Change: Q2519R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 38 49 N/A INTRINSIC
EGF 118 146 8.52e0 SMART
EGF 149 178 5.4e-2 SMART
Pfam:TB 194 232 3.5e-10 PFAM
EGF_CA 246 287 3.56e-11 SMART
EGF_CA 288 329 9.39e-11 SMART
Pfam:TB 344 388 6.8e-15 PFAM
low complexity region 394 445 N/A INTRINSIC
EGF 454 491 8.57e-5 SMART
EGF_CA 492 531 9.39e-11 SMART
EGF_CA 532 573 2.38e-12 SMART
EGF_CA 574 614 5.48e-12 SMART
EGF_CA 615 655 5.39e-11 SMART
Pfam:TB 671 712 8.3e-16 PFAM
EGF_CA 725 766 1.53e-10 SMART
EGF_CA 767 808 2.42e-13 SMART
EGF_CA 809 848 2.44e-9 SMART
Pfam:TB 863 898 3.1e-8 PFAM
EGF_CA 912 953 3.32e-11 SMART
Pfam:TB 968 1009 1.5e-15 PFAM
EGF_CA 1030 1071 5.11e-12 SMART
EGF_CA 1072 1114 5.39e-11 SMART
EGF_CA 1115 1156 1.55e-11 SMART
EGF_CA 1157 1198 5.48e-12 SMART
EGF_CA 1199 1239 5.61e-9 SMART
EGF_CA 1240 1281 1.22e-9 SMART
EGF_CA 1282 1323 2.62e-9 SMART
EGF_CA 1324 1364 3.27e-10 SMART
EGF_CA 1365 1405 4.7e-11 SMART
EGF_CA 1406 1447 1.91e-11 SMART
EGF_CA 1448 1488 1.98e-9 SMART
EGF_CA 1489 1529 2.13e-9 SMART
Pfam:TB 1550 1590 5.3e-17 PFAM
EGF_CA 1608 1649 2.19e-11 SMART
EGF_CA 1650 1690 3.97e-9 SMART
Pfam:TB 1707 1749 1.6e-16 PFAM
EGF_CA 1768 1809 5.11e-12 SMART
EGF_CA 1810 1850 1.1e-11 SMART
EGF_CA 1851 1892 5.69e-10 SMART
EGF_CA 1893 1931 6.1e-10 SMART
EGF_CA 1932 1974 2.11e-13 SMART
EGF_CA 1975 2014 7.23e-12 SMART
EGF_CA 2015 2056 3.15e-12 SMART
Pfam:TB 2071 2112 1.9e-15 PFAM
EGF_CA 2129 2167 1.24e-10 SMART
EGF_CA 2168 2207 3.81e-11 SMART
EGF_CA 2208 2248 3.81e-11 SMART
EGF 2252 2292 5.24e0 SMART
EGF_CA 2293 2334 9.91e-10 SMART
Pfam:TB 2349 2391 5.8e-15 PFAM
EGF_CA 2404 2445 1.26e-11 SMART
EGF_CA 2446 2486 1.06e-9 SMART
EGF_CA 2487 2525 3.1e-11 SMART
EGF_CA 2526 2568 1.48e-8 SMART
EGF_CA 2569 2608 1.14e-9 SMART
EGF_CA 2609 2649 3.97e-9 SMART
EGF_CA 2650 2689 1.98e-9 SMART
low complexity region 2691 2698 N/A INTRINSIC
Meta Mutation Damage Score 0.2678 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 99% (104/105)
MGI Phenotype Strain: 1934905; 4880665
Lethality: D7-D10
FUNCTION: This gene encodes a member of the fibrillin family of proteins. The encoded preproprotein is proteolytically processed to generate two proteins including the extracellular matrix component fibrillin-1 and the protein hormone asprosin. Fibrillin-1 is an extracellular matrix glycoprotein that serves as a structural component of calcium-binding microfibrils. Asprosin, secreted by white adipose tissue, has been shown to regulate glucose homeostasis. Homozygous knockout mice for this gene exhibit impaired aortic development and early postnatal death, which was attributed to a deficiency in the fibrillin-1 protein. Mice with a hypomorphic allele of this gene exhibit impaired glucose homeostasis, likely due to a reduction in serum asprosin levels. [provided by RefSeq, Apr 2016]
PHENOTYPE: Lethality among homozygotes for spontaneous and targeted mutations ranges from embryonic death to death around 4 months. Abnormalities include vascular defects, excess bone growth, connective tissue hyperplasia, and lung emphysema. Mice heterozygous for a knock-in allele exhibit scleroderma. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(9) Spontaneous(1)

Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,732,917 Q401R probably benign Het
Acpp A G 9: 104,314,427 F220S probably damaging Het
Adam7 A G 14: 68,509,656 probably benign Het
Adamts6 A G 13: 104,390,076 probably null Het
Ascc3 T C 10: 50,748,955 probably benign Het
Atg10 T C 13: 91,040,990 probably null Het
Atm T C 9: 53,458,838 I2325V possibly damaging Het
Btnl9 C T 11: 49,169,616 R435H possibly damaging Het
Ccdc180 A G 4: 45,923,551 K1111E probably damaging Het
Col11a2 T A 17: 34,062,446 probably null Het
Ctcfl A G 2: 173,118,443 W116R probably damaging Het
Ctsk A T 3: 95,500,944 Y37F probably damaging Het
Daam2 G C 17: 49,480,785 probably null Het
Dcdc2b T C 4: 129,610,238 probably null Het
Ddx28 C T 8: 106,011,294 R44Q probably damaging Het
Dhx29 T A 13: 112,962,859 N1139K probably benign Het
Dnah17 A T 11: 118,098,539 M1281K probably benign Het
Dnah6 T C 6: 73,208,609 S110G probably benign Het
Drc7 T C 8: 95,072,855 Y553H probably benign Het
Dync2h1 T C 9: 7,005,487 probably null Het
Ecm1 A G 3: 95,737,057 I152T possibly damaging Het
Edc4 C G 8: 105,886,775 P307R probably damaging Het
Egr1 A G 18: 34,863,313 T383A possibly damaging Het
Eml2 A G 7: 19,190,806 probably null Het
Eno4 A G 19: 58,943,624 probably benign Het
Erbb4 A T 1: 68,330,270 I404K probably damaging Het
Exoc7 G T 11: 116,295,662 T310K probably benign Het
Fam102b C T 3: 108,980,181 E256K probably benign Het
Fam83e G T 7: 45,726,969 V369L probably benign Het
Fam96b T C 8: 104,641,590 D34G probably null Het
Fancc A T 13: 63,398,156 I91K possibly damaging Het
Fhod3 T A 18: 25,090,076 C826* probably null Het
Foxi3 A G 6: 70,956,628 D33G probably benign Het
Gcn1l1 T C 5: 115,576,108 probably benign Het
Gm14221 T C 2: 160,568,390 noncoding transcript Het
Golga4 T A 9: 118,555,785 H630Q probably benign Het
Gpat4 T C 8: 23,180,933 S88G probably benign Het
Gucy2d A T 7: 98,443,685 S90C probably damaging Het
Has2 A C 15: 56,681,661 C182G probably damaging Het
Heatr5a A T 12: 51,888,861 S1647R probably damaging Het
Ifi35 T C 11: 101,457,212 V48A probably benign Het
Lig1 T A 7: 13,296,804 probably benign Het
Magi2 A G 5: 19,227,575 K96R probably damaging Het
Map7d1 G T 4: 126,234,994 P462Q probably damaging Het
Mdn1 A T 4: 32,746,439 probably null Het
Mfsd4a A T 1: 132,059,275 V105E probably damaging Het
Mrpl53 C T 6: 83,109,545 R77C probably damaging Het
Mtnr1b C T 9: 15,874,304 V53M probably damaging Het
Myo9b T C 8: 71,347,770 W990R probably damaging Het
Myt1 A T 2: 181,763,393 probably benign Het
Nf1 C T 11: 79,536,878 A1766V probably damaging Het
Nlrp3 T C 11: 59,548,797 V400A possibly damaging Het
Nup205 T A 6: 35,196,714 probably null Het
Nxf1 T C 19: 8,764,151 probably null Het
Olfr1352 A T 10: 78,984,386 M199L probably benign Het
P4hb T C 11: 120,563,336 K311E probably benign Het
Pafah1b1 T C 11: 74,683,631 N243S probably benign Het
Parp8 G A 13: 116,924,968 Q141* probably null Het
Pkd2l2 A C 18: 34,435,327 D543A probably benign Het
Pld5 A T 1: 175,975,580 L311* probably null Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plpp5 A T 8: 25,724,192 T144S probably benign Het
Ppp6r3 A G 19: 3,478,285 L542S probably damaging Het
Prkar2b A T 12: 31,987,974 probably null Het
Psmg1 A T 16: 95,987,971 S129T possibly damaging Het
Radil T C 5: 142,543,827 D38G probably benign Het
Ric1 T C 19: 29,601,011 probably null Het
Rp1l1 T A 14: 64,031,066 L1367* probably null Het
Rxfp1 A T 3: 79,737,793 M1K probably null Het
Serpina6 G T 12: 103,651,949 L202I probably damaging Het
Simc1 T C 13: 54,528,467 I98T probably damaging Het
Slc17a6 A G 7: 51,658,771 Y281C probably damaging Het
Slc26a11 T A 11: 119,379,941 probably benign Het
Slc34a1 T A 13: 55,402,898 probably null Het
Slfn10-ps T A 11: 83,035,774 noncoding transcript Het
Sohlh2 A G 3: 55,207,742 N383D probably damaging Het
Spag6 T A 2: 18,710,491 L27H probably damaging Het
Sptlc3 A G 2: 139,546,555 probably benign Het
St3gal4 T A 9: 35,053,173 K199* probably null Het
Stat5a T A 11: 100,882,083 D712E probably benign Het
Stmn2 A T 3: 8,545,690 D78V probably damaging Het
Stpg1 C T 4: 135,506,466 P20S possibly damaging Het
Taf2 A T 15: 55,045,929 V640E probably damaging Het
Tbce T C 13: 13,998,162 E501G probably benign Het
Tecpr2 A G 12: 110,968,940 S1398G probably damaging Het
Tenm4 T A 7: 96,772,035 Y598* probably null Het
Ticrr A G 7: 79,677,340 S599G probably damaging Het
Tnc A C 4: 64,017,442 V419G probably damaging Het
Trappc1 C A 11: 69,325,576 P110T probably benign Het
Trbv12-2 C T 6: 41,119,059 probably benign Het
Ttbk2 A T 2: 120,745,783 N835K possibly damaging Het
Tubgcp5 A G 7: 55,800,684 D181G probably damaging Het
Tut1 T C 19: 8,955,527 Y75H possibly damaging Het
Ulk2 C A 11: 61,787,586 C769F probably benign Het
Vdac1 T C 11: 52,374,973 probably benign Het
Vmn2r124 T C 17: 18,064,224 probably null Het
Vps8 T C 16: 21,608,227 probably benign Het
Wdr35 T C 12: 8,995,625 probably benign Het
Zdhhc7 T A 8: 120,086,647 E141V probably null Het
Zfp12 C A 5: 143,245,223 S435Y probably damaging Het
Zfp974 A T 7: 27,927,394 probably benign Het
Zfyve9 T A 4: 108,680,969 K1033N probably damaging Het
Zswim8 T A 14: 20,721,945 S1572T possibly damaging Het
Other mutations in Fbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Fbn1 APN 2 125324947 missense probably damaging 1.00
IGL00159:Fbn1 APN 2 125397873 missense probably benign 0.14
IGL00500:Fbn1 APN 2 125317516 missense probably damaging 0.99
IGL00558:Fbn1 APN 2 125329128 splice site probably benign
IGL00645:Fbn1 APN 2 125317103 splice site probably benign
IGL00863:Fbn1 APN 2 125403219 missense possibly damaging 0.84
IGL00926:Fbn1 APN 2 125319042 missense possibly damaging 0.84
IGL00935:Fbn1 APN 2 125377910 nonsense probably null
IGL00950:Fbn1 APN 2 125358823 missense probably damaging 1.00
IGL01090:Fbn1 APN 2 125394776 splice site probably benign
IGL01106:Fbn1 APN 2 125351706 missense possibly damaging 0.55
IGL01486:Fbn1 APN 2 125389978 missense probably benign 0.03
IGL01519:Fbn1 APN 2 125317019 missense probably benign 0.07
IGL01585:Fbn1 APN 2 125360110 missense probably damaging 0.98
IGL01730:Fbn1 APN 2 125312974 splice site probably benign
IGL01793:Fbn1 APN 2 125387293 missense possibly damaging 0.67
IGL01803:Fbn1 APN 2 125350287 missense probably damaging 1.00
IGL01803:Fbn1 APN 2 125301725 missense probably benign
IGL01916:Fbn1 APN 2 125315446 missense possibly damaging 0.55
IGL02035:Fbn1 APN 2 125335362 splice site probably null
IGL02097:Fbn1 APN 2 125363969 missense probably damaging 1.00
IGL02233:Fbn1 APN 2 125321610 splice site probably benign
IGL02512:Fbn1 APN 2 125338460 missense probably damaging 1.00
IGL02552:Fbn1 APN 2 125412713 missense possibly damaging 0.86
IGL02657:Fbn1 APN 2 125352025 missense possibly damaging 0.86
IGL02718:Fbn1 APN 2 125369886 missense probably damaging 1.00
IGL02863:Fbn1 APN 2 125303256 missense possibly damaging 0.80
IGL02974:Fbn1 APN 2 125346330 missense probably null 0.99
IGL03058:Fbn1 APN 2 125403200 missense probably benign 0.03
IGL03172:Fbn1 APN 2 125320968 missense possibly damaging 0.92
IGL03288:Fbn1 APN 2 125303183 missense probably benign 0.13
Carinatum UTSW 2 125342830 missense possibly damaging 0.70
lincoln UTSW 2 125403170 missense possibly damaging 0.50
reaper UTSW 2 125315404 missense probably damaging 0.98
Scythe UTSW 2 125403228 missense possibly damaging 0.84
string_bean UTSW 2 125379134 splice site probably null
wirey UTSW 2 125309495 missense probably benign
3-1:Fbn1 UTSW 2 125394605 splice site probably benign
P0012:Fbn1 UTSW 2 125369321 splice site probably benign
PIT4403001:Fbn1 UTSW 2 125342911 missense probably damaging 1.00
PIT4466001:Fbn1 UTSW 2 125306501 missense possibly damaging 0.90
PIT4472001:Fbn1 UTSW 2 125306501 missense possibly damaging 0.90
PIT4651001:Fbn1 UTSW 2 125363989 critical splice acceptor site probably null
R0226:Fbn1 UTSW 2 125320910 missense possibly damaging 0.86
R0310:Fbn1 UTSW 2 125363644 missense probably damaging 1.00
R0374:Fbn1 UTSW 2 125321676 missense possibly damaging 0.86
R0433:Fbn1 UTSW 2 125348215 missense possibly damaging 0.95
R0441:Fbn1 UTSW 2 125309755 critical splice donor site probably null
R0501:Fbn1 UTSW 2 125301749 missense probably benign 0.23
R0510:Fbn1 UTSW 2 125342925 splice site probably benign
R0573:Fbn1 UTSW 2 125389249 missense probably damaging 0.99
R0622:Fbn1 UTSW 2 125379024 missense possibly damaging 0.88
R0630:Fbn1 UTSW 2 125394770 missense possibly damaging 0.48
R0724:Fbn1 UTSW 2 125352064 missense probably benign 0.14
R0739:Fbn1 UTSW 2 125367630 missense probably benign 0.18
R0744:Fbn1 UTSW 2 125314814 splice site probably benign
R0811:Fbn1 UTSW 2 125403170 missense possibly damaging 0.50
R0812:Fbn1 UTSW 2 125403170 missense possibly damaging 0.50
R0862:Fbn1 UTSW 2 125342891 nonsense probably null
R0864:Fbn1 UTSW 2 125342891 nonsense probably null
R1061:Fbn1 UTSW 2 125345963 missense probably benign 0.01
R1126:Fbn1 UTSW 2 125321192 splice site probably null
R1172:Fbn1 UTSW 2 125394687 missense probably benign 0.13
R1175:Fbn1 UTSW 2 125394687 missense probably benign 0.13
R1183:Fbn1 UTSW 2 125321617 missense probably benign 0.07
R1218:Fbn1 UTSW 2 125412749 missense possibly damaging 0.71
R1241:Fbn1 UTSW 2 125372527 splice site probably benign
R1248:Fbn1 UTSW 2 125301609 missense probably benign 0.01
R1345:Fbn1 UTSW 2 125314671 missense probably damaging 1.00
R1374:Fbn1 UTSW 2 125346434 missense probably damaging 0.99
R1458:Fbn1 UTSW 2 125301929 missense probably benign 0.01
R1474:Fbn1 UTSW 2 125361265 missense possibly damaging 0.72
R1496:Fbn1 UTSW 2 125309495 missense probably benign
R1502:Fbn1 UTSW 2 125363706 nonsense probably null
R1511:Fbn1 UTSW 2 125306285 missense probably benign 0.00
R1588:Fbn1 UTSW 2 125319114 missense probably benign 0.19
R1626:Fbn1 UTSW 2 125341279 missense probably damaging 1.00
R1676:Fbn1 UTSW 2 125309781 missense probably damaging 1.00
R1712:Fbn1 UTSW 2 125346434 missense probably damaging 0.99
R1772:Fbn1 UTSW 2 125403228 missense possibly damaging 0.84
R1776:Fbn1 UTSW 2 125321734 missense possibly damaging 0.71
R1869:Fbn1 UTSW 2 125352027 missense probably benign 0.00
R1894:Fbn1 UTSW 2 125394621 missense probably damaging 0.96
R1925:Fbn1 UTSW 2 125363629 missense probably damaging 1.00
R1957:Fbn1 UTSW 2 125367654 missense possibly damaging 0.93
R1995:Fbn1 UTSW 2 125350373 critical splice acceptor site probably null
R2140:Fbn1 UTSW 2 125343810 missense probably damaging 1.00
R2142:Fbn1 UTSW 2 125412708 missense possibly damaging 0.93
R2268:Fbn1 UTSW 2 125321741 missense possibly damaging 0.49
R3409:Fbn1 UTSW 2 125412665 missense possibly damaging 0.92
R3418:Fbn1 UTSW 2 125320926 missense possibly damaging 0.55
R3508:Fbn1 UTSW 2 125306327 missense probably benign 0.19
R3778:Fbn1 UTSW 2 125317086 missense probably damaging 1.00
R3800:Fbn1 UTSW 2 125345974 missense possibly damaging 0.63
R4001:Fbn1 UTSW 2 125477495 critical splice donor site probably null
R4169:Fbn1 UTSW 2 125363952 missense possibly damaging 0.86
R4398:Fbn1 UTSW 2 125397781 missense probably benign 0.32
R4482:Fbn1 UTSW 2 125363610 critical splice donor site probably null
R4559:Fbn1 UTSW 2 125351714 missense possibly damaging 0.65
R4608:Fbn1 UTSW 2 125306500 missense probably benign 0.05
R4634:Fbn1 UTSW 2 125344061 missense probably damaging 1.00
R4706:Fbn1 UTSW 2 125370149 missense probably benign 0.21
R4712:Fbn1 UTSW 2 125341316 missense probably benign 0.12
R4783:Fbn1 UTSW 2 125324919 missense probably damaging 1.00
R4784:Fbn1 UTSW 2 125324919 missense probably damaging 1.00
R4785:Fbn1 UTSW 2 125324919 missense probably damaging 1.00
R4793:Fbn1 UTSW 2 125321235 nonsense probably null
R4838:Fbn1 UTSW 2 125372399 missense probably benign 0.01
R4864:Fbn1 UTSW 2 125372397 missense possibly damaging 0.92
R4887:Fbn1 UTSW 2 125309774 missense probably damaging 1.00
R4942:Fbn1 UTSW 2 125383616 missense possibly damaging 0.88
R4952:Fbn1 UTSW 2 125317534 missense probably damaging 1.00
R5030:Fbn1 UTSW 2 125412704 missense possibly damaging 0.51
R5044:Fbn1 UTSW 2 125329102 missense probably damaging 0.97
R5057:Fbn1 UTSW 2 125466695 missense probably benign 0.33
R5115:Fbn1 UTSW 2 125332383 missense probably damaging 1.00
R5399:Fbn1 UTSW 2 125332333 missense possibly damaging 0.69
R5498:Fbn1 UTSW 2 125360176 missense probably damaging 1.00
R5526:Fbn1 UTSW 2 125365639 missense possibly damaging 0.83
R5529:Fbn1 UTSW 2 125373950 missense probably benign 0.01
R5602:Fbn1 UTSW 2 125321741 missense possibly damaging 0.49
R5760:Fbn1 UTSW 2 125361247 missense probably damaging 1.00
R5837:Fbn1 UTSW 2 125379134 splice site probably null
R5955:Fbn1 UTSW 2 125358882 missense probably damaging 1.00
R5980:Fbn1 UTSW 2 125315404 missense probably damaging 0.98
R6039:Fbn1 UTSW 2 125363880 missense probably damaging 1.00
R6039:Fbn1 UTSW 2 125363880 missense probably damaging 1.00
R6058:Fbn1 UTSW 2 125466612 missense possibly damaging 0.73
R6089:Fbn1 UTSW 2 125321225 missense possibly damaging 0.55
R6136:Fbn1 UTSW 2 125403132 missense possibly damaging 0.63
R6161:Fbn1 UTSW 2 125369801 nonsense probably null
R6162:Fbn1 UTSW 2 125360227 missense probably damaging 1.00
R6165:Fbn1 UTSW 2 125332363 missense probably damaging 0.99
R6169:Fbn1 UTSW 2 125335489 critical splice acceptor site probably null
R6221:Fbn1 UTSW 2 125320921 missense probably benign 0.07
R6223:Fbn1 UTSW 2 125412671 missense possibly damaging 0.86
R6225:Fbn1 UTSW 2 125330543 missense probably damaging 1.00
R6238:Fbn1 UTSW 2 125324945 missense probably damaging 0.98
R6329:Fbn1 UTSW 2 125308473 missense possibly damaging 0.70
R6401:Fbn1 UTSW 2 125346450 missense probably damaging 0.98
R6480:Fbn1 UTSW 2 125335418 missense probably benign 0.05
R6513:Fbn1 UTSW 2 125383671 missense probably damaging 1.00
R6530:Fbn1 UTSW 2 125389270 missense probably damaging 0.99
R6595:Fbn1 UTSW 2 125342830 missense possibly damaging 0.70
R6781:Fbn1 UTSW 2 125317038 missense probably damaging 1.00
R6849:Fbn1 UTSW 2 125321691 missense possibly damaging 0.82
R6860:Fbn1 UTSW 2 125328158 missense probably damaging 1.00
R6960:Fbn1 UTSW 2 125382060 missense probably benign 0.16
R7134:Fbn1 UTSW 2 125382049 missense probably benign 0.03
R7241:Fbn1 UTSW 2 125306495 missense possibly damaging 0.86
R7295:Fbn1 UTSW 2 125335487 missense probably damaging 1.00
R7312:Fbn1 UTSW 2 125466674 missense possibly damaging 0.53
R7322:Fbn1 UTSW 2 125479195 missense possibly damaging 0.92
R7349:Fbn1 UTSW 2 125315401 missense possibly damaging 0.84
R7365:Fbn1 UTSW 2 125352049 missense probably damaging 0.97
R7392:Fbn1 UTSW 2 125343924 missense probably damaging 1.00
R7442:Fbn1 UTSW 2 125403212 missense possibly damaging 0.45
R7452:Fbn1 UTSW 2 125505455 missense possibly damaging 0.53
R7453:Fbn1 UTSW 2 125320959 missense possibly damaging 0.93
R7457:Fbn1 UTSW 2 125351747 missense possibly damaging 0.90
R7458:Fbn1 UTSW 2 125319116 missense probably benign 0.14
R7549:Fbn1 UTSW 2 125344027 missense probably damaging 0.99
R7570:Fbn1 UTSW 2 125397852 missense probably benign 0.29
R7666:Fbn1 UTSW 2 125306471 missense probably damaging 1.00
R7723:Fbn1 UTSW 2 125382034 nonsense probably null
R7745:Fbn1 UTSW 2 125303195 missense probably benign 0.06
R7780:Fbn1 UTSW 2 125301758 missense probably benign 0.15
R7849:Fbn1 UTSW 2 125309485 missense probably damaging 0.98
R7932:Fbn1 UTSW 2 125309485 missense probably damaging 0.98
R7948:Fbn1 UTSW 2 125341299 missense not run
R8051:Fbn1 UTSW 2 125306463 missense not run
R8054:Fbn1 UTSW 2 125346018 missense not run
R8058:Fbn1 UTSW 2 125351969 missense not run
X0019:Fbn1 UTSW 2 125383643 missense possibly damaging 0.82
X0020:Fbn1 UTSW 2 125369340 missense probably damaging 1.00
X0028:Fbn1 UTSW 2 125342798 critical splice donor site probably null
X0067:Fbn1 UTSW 2 125369914 missense possibly damaging 0.95
Z1088:Fbn1 UTSW 2 125350288 missense probably damaging 0.99
Z1176:Fbn1 UTSW 2 125387350 missense not run
Z1177:Fbn1 UTSW 2 125389231 missense not run
Predicted Primers PCR Primer
(F):5'- TTCTGGCAAACACCCTTGGACC -3'
(R):5'- CAGCGCCTTGCTGTGACTTCTG -3'

Sequencing Primer
(F):5'- CACTCATTGTTATCTGGGAGAAGC -3'
(R):5'- GCTGTGACTTCTGGGCTG -3'
Posted On2013-05-09