Incidental Mutation 'R0362:Ecm1'
ID36219
Institutional Source Beutler Lab
Gene Symbol Ecm1
Ensembl Gene ENSMUSG00000028108
Gene Nameextracellular matrix protein 1
Synonymsp85
MMRRC Submission 038568-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R0362 (G1)
Quality Score197
Status Validated
Chromosome3
Chromosomal Location95734147-95739569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95737057 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 152 (I152T)
Ref Sequence ENSEMBL: ENSMUSP00000114747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029752] [ENSMUST00000029753] [ENSMUST00000074339] [ENSMUST00000117507] [ENSMUST00000123143] [ENSMUST00000128885] [ENSMUST00000131376] [ENSMUST00000137912] [ENSMUST00000147217] [ENSMUST00000153026] [ENSMUST00000163530] [ENSMUST00000196077] [ENSMUST00000199464]
Predicted Effect probably benign
Transcript: ENSMUST00000029752
SMART Domains Protein: ENSMUSP00000029752
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 5.6e-14 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
Pfam:tRNA-synt_2b 400 608 2.4e-32 PFAM
Pfam:HGTP_anticodon 620 711 1.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029753
SMART Domains Protein: ENSMUSP00000029753
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 558 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000074339
SMART Domains Protein: ENSMUSP00000073946
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.3e-15 PFAM
tRNA_SAD 233 282 1.15e-10 SMART
Pfam:tRNA-synt_2b 336 519 2.8e-39 PFAM
Pfam:HGTP_anticodon 594 685 5.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117507
AA Change: I134T

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112665
Gene: ENSMUSG00000028108
AA Change: I134T

DomainStartEndE-ValueType
Pfam:ECM1 1 559 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000123143
AA Change: I117T

PolyPhen 2 Score 0.522 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120300
Gene: ENSMUSG00000028108
AA Change: I117T

DomainStartEndE-ValueType
Pfam:ECM1 1 266 4.4e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128885
AA Change: I126T

PolyPhen 2 Score 0.276 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120820
Gene: ENSMUSG00000028108
AA Change: I126T

DomainStartEndE-ValueType
Pfam:ECM1 1 251 1.5e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131376
SMART Domains Protein: ENSMUSP00000114659
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 295 4.2e-146 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137912
SMART Domains Protein: ENSMUSP00000122243
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 140 1.8e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144958
Predicted Effect probably benign
Transcript: ENSMUST00000147217
SMART Domains Protein: ENSMUSP00000115524
Gene: ENSMUSG00000028108

DomainStartEndE-ValueType
Pfam:ECM1 1 80 5.2e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000153026
AA Change: I152T

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114747
Gene: ENSMUSG00000028108
AA Change: I152T

DomainStartEndE-ValueType
Pfam:ECM1 1 230 1.3e-100 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155815
Predicted Effect probably benign
Transcript: ENSMUST00000163530
SMART Domains Protein: ENSMUSP00000130269
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 2.6e-15 PFAM
tRNA_SAD 152 201 1.15e-10 SMART
Pfam:tRNA-synt_2b 255 438 8.6e-40 PFAM
Pfam:HGTP_anticodon 539 630 1.6e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183853
Predicted Effect probably benign
Transcript: ENSMUST00000196077
SMART Domains Protein: ENSMUSP00000143722
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 65 125 5e-13 PFAM
tRNA_SAD 232 264 7.5e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199464
SMART Domains Protein: ENSMUSP00000143328
Gene: ENSMUSG00000028107

DomainStartEndE-ValueType
Pfam:TGS 66 126 1.1e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200376
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 99% (104/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a soluble protein that is involved in endochondral bone formation, angiogenesis, and tumor biology. It also interacts with a variety of extracellular and structural proteins, contributing to the maintenance of skin integrity and homeostasis. Mutations in this gene are associated with lipoid proteinosis disorder (also known as hyalinosis cutis et mucosae or Urbach-Wiethe disease) that is characterized by generalized thickening of skin, mucosae and certain viscera. Alternatively spliced transcript variants encoding distinct isoforms have been described for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit auto-inflammatory disease and do not survive beyond 6 to 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,732,917 Q401R probably benign Het
Acpp A G 9: 104,314,427 F220S probably damaging Het
Adam7 A G 14: 68,509,656 probably benign Het
Adamts6 A G 13: 104,390,076 probably null Het
Ascc3 T C 10: 50,748,955 probably benign Het
Atg10 T C 13: 91,040,990 probably null Het
Atm T C 9: 53,458,838 I2325V possibly damaging Het
Btnl9 C T 11: 49,169,616 R435H possibly damaging Het
Ccdc180 A G 4: 45,923,551 K1111E probably damaging Het
Col11a2 T A 17: 34,062,446 probably null Het
Ctcfl A G 2: 173,118,443 W116R probably damaging Het
Ctsk A T 3: 95,500,944 Y37F probably damaging Het
Daam2 G C 17: 49,480,785 probably null Het
Dcdc2b T C 4: 129,610,238 probably null Het
Ddx28 C T 8: 106,011,294 R44Q probably damaging Het
Dhx29 T A 13: 112,962,859 N1139K probably benign Het
Dnah17 A T 11: 118,098,539 M1281K probably benign Het
Dnah6 T C 6: 73,208,609 S110G probably benign Het
Drc7 T C 8: 95,072,855 Y553H probably benign Het
Dync2h1 T C 9: 7,005,487 probably null Het
Edc4 C G 8: 105,886,775 P307R probably damaging Het
Egr1 A G 18: 34,863,313 T383A possibly damaging Het
Eml2 A G 7: 19,190,806 probably null Het
Eno4 A G 19: 58,943,624 probably benign Het
Erbb4 A T 1: 68,330,270 I404K probably damaging Het
Exoc7 G T 11: 116,295,662 T310K probably benign Het
Fam102b C T 3: 108,980,181 E256K probably benign Het
Fam83e G T 7: 45,726,969 V369L probably benign Het
Fam96b T C 8: 104,641,590 D34G probably null Het
Fancc A T 13: 63,398,156 I91K possibly damaging Het
Fbn1 T C 2: 125,309,777 Q2519R probably damaging Het
Fhod3 T A 18: 25,090,076 C826* probably null Het
Foxi3 A G 6: 70,956,628 D33G probably benign Het
Gcn1l1 T C 5: 115,576,108 probably benign Het
Gm14221 T C 2: 160,568,390 noncoding transcript Het
Golga4 T A 9: 118,555,785 H630Q probably benign Het
Gpat4 T C 8: 23,180,933 S88G probably benign Het
Gucy2d A T 7: 98,443,685 S90C probably damaging Het
Has2 A C 15: 56,681,661 C182G probably damaging Het
Heatr5a A T 12: 51,888,861 S1647R probably damaging Het
Ifi35 T C 11: 101,457,212 V48A probably benign Het
Lig1 T A 7: 13,296,804 probably benign Het
Magi2 A G 5: 19,227,575 K96R probably damaging Het
Map7d1 G T 4: 126,234,994 P462Q probably damaging Het
Mdn1 A T 4: 32,746,439 probably null Het
Mfsd4a A T 1: 132,059,275 V105E probably damaging Het
Mrpl53 C T 6: 83,109,545 R77C probably damaging Het
Mtnr1b C T 9: 15,874,304 V53M probably damaging Het
Myo9b T C 8: 71,347,770 W990R probably damaging Het
Myt1 A T 2: 181,763,393 probably benign Het
Nf1 C T 11: 79,536,878 A1766V probably damaging Het
Nlrp3 T C 11: 59,548,797 V400A possibly damaging Het
Nup205 T A 6: 35,196,714 probably null Het
Nxf1 T C 19: 8,764,151 probably null Het
Olfr1352 A T 10: 78,984,386 M199L probably benign Het
P4hb T C 11: 120,563,336 K311E probably benign Het
Pafah1b1 T C 11: 74,683,631 N243S probably benign Het
Parp8 G A 13: 116,924,968 Q141* probably null Het
Pkd2l2 A C 18: 34,435,327 D543A probably benign Het
Pld5 A T 1: 175,975,580 L311* probably null Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plpp5 A T 8: 25,724,192 T144S probably benign Het
Ppp6r3 A G 19: 3,478,285 L542S probably damaging Het
Prkar2b A T 12: 31,987,974 probably null Het
Psmg1 A T 16: 95,987,971 S129T possibly damaging Het
Radil T C 5: 142,543,827 D38G probably benign Het
Ric1 T C 19: 29,601,011 probably null Het
Rp1l1 T A 14: 64,031,066 L1367* probably null Het
Rxfp1 A T 3: 79,737,793 M1K probably null Het
Serpina6 G T 12: 103,651,949 L202I probably damaging Het
Simc1 T C 13: 54,528,467 I98T probably damaging Het
Slc17a6 A G 7: 51,658,771 Y281C probably damaging Het
Slc26a11 T A 11: 119,379,941 probably benign Het
Slc34a1 T A 13: 55,402,898 probably null Het
Slfn10-ps T A 11: 83,035,774 noncoding transcript Het
Sohlh2 A G 3: 55,207,742 N383D probably damaging Het
Spag6 T A 2: 18,710,491 L27H probably damaging Het
Sptlc3 A G 2: 139,546,555 probably benign Het
St3gal4 T A 9: 35,053,173 K199* probably null Het
Stat5a T A 11: 100,882,083 D712E probably benign Het
Stmn2 A T 3: 8,545,690 D78V probably damaging Het
Stpg1 C T 4: 135,506,466 P20S possibly damaging Het
Taf2 A T 15: 55,045,929 V640E probably damaging Het
Tbce T C 13: 13,998,162 E501G probably benign Het
Tecpr2 A G 12: 110,968,940 S1398G probably damaging Het
Tenm4 T A 7: 96,772,035 Y598* probably null Het
Ticrr A G 7: 79,677,340 S599G probably damaging Het
Tnc A C 4: 64,017,442 V419G probably damaging Het
Trappc1 C A 11: 69,325,576 P110T probably benign Het
Trbv12-2 C T 6: 41,119,059 probably benign Het
Ttbk2 A T 2: 120,745,783 N835K possibly damaging Het
Tubgcp5 A G 7: 55,800,684 D181G probably damaging Het
Tut1 T C 19: 8,955,527 Y75H possibly damaging Het
Ulk2 C A 11: 61,787,586 C769F probably benign Het
Vdac1 T C 11: 52,374,973 probably benign Het
Vmn2r124 T C 17: 18,064,224 probably null Het
Vps8 T C 16: 21,608,227 probably benign Het
Wdr35 T C 12: 8,995,625 probably benign Het
Zdhhc7 T A 8: 120,086,647 E141V probably null Het
Zfp12 C A 5: 143,245,223 S435Y probably damaging Het
Zfp974 A T 7: 27,927,394 probably benign Het
Zfyve9 T A 4: 108,680,969 K1033N probably damaging Het
Zswim8 T A 14: 20,721,945 S1572T possibly damaging Het
Other mutations in Ecm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Ecm1 APN 3 95734899 missense probably damaging 1.00
IGL01686:Ecm1 APN 3 95736064 missense probably benign
IGL01807:Ecm1 APN 3 95736579 missense probably damaging 1.00
IGL01862:Ecm1 APN 3 95734273 missense probably benign 0.08
IGL02006:Ecm1 APN 3 95734244 missense probably damaging 0.98
IGL02134:Ecm1 APN 3 95736187 missense probably damaging 1.00
IGL02210:Ecm1 APN 3 95735977 missense probably damaging 0.97
IGL02813:Ecm1 APN 3 95736786 missense probably damaging 0.99
IGL02959:Ecm1 APN 3 95737677 missense probably damaging 1.00
R0963:Ecm1 UTSW 3 95736588 missense possibly damaging 0.95
R1181:Ecm1 UTSW 3 95735350 missense possibly damaging 0.85
R1230:Ecm1 UTSW 3 95735426 splice site probably null
R1483:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1484:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1559:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1561:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1562:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1590:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R1591:Ecm1 UTSW 3 95735963 missense probably damaging 1.00
R2110:Ecm1 UTSW 3 95735942 missense probably benign 0.14
R3236:Ecm1 UTSW 3 95734846 missense possibly damaging 0.71
R3897:Ecm1 UTSW 3 95735986 missense probably damaging 0.99
R4084:Ecm1 UTSW 3 95734363 missense probably damaging 0.98
R4770:Ecm1 UTSW 3 95737961 unclassified probably benign
R4985:Ecm1 UTSW 3 95736103 missense possibly damaging 0.55
R5506:Ecm1 UTSW 3 95735857 missense probably benign 0.00
R5861:Ecm1 UTSW 3 95736597 missense probably damaging 1.00
R7472:Ecm1 UTSW 3 95735320 missense possibly damaging 0.93
R7678:Ecm1 UTSW 3 95736182 missense probably damaging 0.97
R7704:Ecm1 UTSW 3 95736531 missense probably damaging 0.99
R7864:Ecm1 UTSW 3 95734376 missense probably benign 0.09
R7947:Ecm1 UTSW 3 95734376 missense probably benign 0.09
Z1088:Ecm1 UTSW 3 95734876 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGTGTGTGGCTTCACTGGAAC -3'
(R):5'- GCCTGTCCAACAGCTCTGTCAATG -3'

Sequencing Primer
(F):5'- CTGGCTGAGCATAGAGCATTG -3'
(R):5'- CTGTCAATGGTGTAAAATAGCAGTCG -3'
Posted On2013-05-09