Incidental Mutation 'R0362:Ccdc180'
ID36222
Institutional Source Beutler Lab
Gene Symbol Ccdc180
Ensembl Gene ENSMUSG00000035539
Gene Namecoiled-coil domain containing 180
SynonymsE230008N13Rik, LOC381522
MMRRC Submission 038568-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0362 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location45890303-45950774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45923551 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1111 (K1111E)
Ref Sequence ENSEMBL: ENSMUSP00000136714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178561]
Predicted Effect probably damaging
Transcript: ENSMUST00000149903
AA Change: K935E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000119784
Gene: ENSMUSG00000035539
AA Change: K935E

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
coiled coil region 90 117 N/A INTRINSIC
Pfam:DUF4455 141 609 2e-189 PFAM
low complexity region 628 642 N/A INTRINSIC
low complexity region 658 675 N/A INTRINSIC
coiled coil region 710 780 N/A INTRINSIC
coiled coil region 945 979 N/A INTRINSIC
low complexity region 1100 1123 N/A INTRINSIC
Pfam:DUF4456 1169 1372 9.5e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151024
SMART Domains Protein: ENSMUSP00000122332
Gene: ENSMUSG00000035539

DomainStartEndE-ValueType
low complexity region 8 22 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
coiled coil region 90 160 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178561
AA Change: K1111E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136714
Gene: ENSMUSG00000035539
AA Change: K1111E

DomainStartEndE-ValueType
low complexity region 32 49 N/A INTRINSIC
coiled coil region 98 125 N/A INTRINSIC
Pfam:DUF4455 148 616 7.3e-189 PFAM
low complexity region 635 649 N/A INTRINSIC
low complexity region 665 682 N/A INTRINSIC
coiled coil region 718 788 N/A INTRINSIC
coiled coil region 1121 1155 N/A INTRINSIC
low complexity region 1275 1298 N/A INTRINSIC
Pfam:DUF4456 1344 1547 2.2e-76 PFAM
Meta Mutation Damage Score 0.2584 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 99% (104/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a coiled-coil domain. Alternative splicing results in multiple transcript variants encoding different isoforms. A single nucleotide polymorphism (SNP) in this gene has been associated with increased susceptibility to Behcet's Disease (PMID: 19442274). [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,732,917 Q401R probably benign Het
Acpp A G 9: 104,314,427 F220S probably damaging Het
Adam7 A G 14: 68,509,656 probably benign Het
Adamts6 A G 13: 104,390,076 probably null Het
Ascc3 T C 10: 50,748,955 probably benign Het
Atg10 T C 13: 91,040,990 probably null Het
Atm T C 9: 53,458,838 I2325V possibly damaging Het
Btnl9 C T 11: 49,169,616 R435H possibly damaging Het
Col11a2 T A 17: 34,062,446 probably null Het
Ctcfl A G 2: 173,118,443 W116R probably damaging Het
Ctsk A T 3: 95,500,944 Y37F probably damaging Het
Daam2 G C 17: 49,480,785 probably null Het
Dcdc2b T C 4: 129,610,238 probably null Het
Ddx28 C T 8: 106,011,294 R44Q probably damaging Het
Dhx29 T A 13: 112,962,859 N1139K probably benign Het
Dnah17 A T 11: 118,098,539 M1281K probably benign Het
Dnah6 T C 6: 73,208,609 S110G probably benign Het
Drc7 T C 8: 95,072,855 Y553H probably benign Het
Dync2h1 T C 9: 7,005,487 probably null Het
Ecm1 A G 3: 95,737,057 I152T possibly damaging Het
Edc4 C G 8: 105,886,775 P307R probably damaging Het
Egr1 A G 18: 34,863,313 T383A possibly damaging Het
Eml2 A G 7: 19,190,806 probably null Het
Eno4 A G 19: 58,943,624 probably benign Het
Erbb4 A T 1: 68,330,270 I404K probably damaging Het
Exoc7 G T 11: 116,295,662 T310K probably benign Het
Fam102b C T 3: 108,980,181 E256K probably benign Het
Fam83e G T 7: 45,726,969 V369L probably benign Het
Fam96b T C 8: 104,641,590 D34G probably null Het
Fancc A T 13: 63,398,156 I91K possibly damaging Het
Fbn1 T C 2: 125,309,777 Q2519R probably damaging Het
Fhod3 T A 18: 25,090,076 C826* probably null Het
Foxi3 A G 6: 70,956,628 D33G probably benign Het
Gcn1l1 T C 5: 115,576,108 probably benign Het
Gm14221 T C 2: 160,568,390 noncoding transcript Het
Golga4 T A 9: 118,555,785 H630Q probably benign Het
Gpat4 T C 8: 23,180,933 S88G probably benign Het
Gucy2d A T 7: 98,443,685 S90C probably damaging Het
Has2 A C 15: 56,681,661 C182G probably damaging Het
Heatr5a A T 12: 51,888,861 S1647R probably damaging Het
Ifi35 T C 11: 101,457,212 V48A probably benign Het
Lig1 T A 7: 13,296,804 probably benign Het
Magi2 A G 5: 19,227,575 K96R probably damaging Het
Map7d1 G T 4: 126,234,994 P462Q probably damaging Het
Mdn1 A T 4: 32,746,439 probably null Het
Mfsd4a A T 1: 132,059,275 V105E probably damaging Het
Mrpl53 C T 6: 83,109,545 R77C probably damaging Het
Mtnr1b C T 9: 15,874,304 V53M probably damaging Het
Myo9b T C 8: 71,347,770 W990R probably damaging Het
Myt1 A T 2: 181,763,393 probably benign Het
Nf1 C T 11: 79,536,878 A1766V probably damaging Het
Nlrp3 T C 11: 59,548,797 V400A possibly damaging Het
Nup205 T A 6: 35,196,714 probably null Het
Nxf1 T C 19: 8,764,151 probably null Het
Olfr1352 A T 10: 78,984,386 M199L probably benign Het
P4hb T C 11: 120,563,336 K311E probably benign Het
Pafah1b1 T C 11: 74,683,631 N243S probably benign Het
Parp8 G A 13: 116,924,968 Q141* probably null Het
Pkd2l2 A C 18: 34,435,327 D543A probably benign Het
Pld5 A T 1: 175,975,580 L311* probably null Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plpp5 A T 8: 25,724,192 T144S probably benign Het
Ppp6r3 A G 19: 3,478,285 L542S probably damaging Het
Prkar2b A T 12: 31,987,974 probably null Het
Psmg1 A T 16: 95,987,971 S129T possibly damaging Het
Radil T C 5: 142,543,827 D38G probably benign Het
Ric1 T C 19: 29,601,011 probably null Het
Rp1l1 T A 14: 64,031,066 L1367* probably null Het
Rxfp1 A T 3: 79,737,793 M1K probably null Het
Serpina6 G T 12: 103,651,949 L202I probably damaging Het
Simc1 T C 13: 54,528,467 I98T probably damaging Het
Slc17a6 A G 7: 51,658,771 Y281C probably damaging Het
Slc26a11 T A 11: 119,379,941 probably benign Het
Slc34a1 T A 13: 55,402,898 probably null Het
Slfn10-ps T A 11: 83,035,774 noncoding transcript Het
Sohlh2 A G 3: 55,207,742 N383D probably damaging Het
Spag6 T A 2: 18,710,491 L27H probably damaging Het
Sptlc3 A G 2: 139,546,555 probably benign Het
St3gal4 T A 9: 35,053,173 K199* probably null Het
Stat5a T A 11: 100,882,083 D712E probably benign Het
Stmn2 A T 3: 8,545,690 D78V probably damaging Het
Stpg1 C T 4: 135,506,466 P20S possibly damaging Het
Taf2 A T 15: 55,045,929 V640E probably damaging Het
Tbce T C 13: 13,998,162 E501G probably benign Het
Tecpr2 A G 12: 110,968,940 S1398G probably damaging Het
Tenm4 T A 7: 96,772,035 Y598* probably null Het
Ticrr A G 7: 79,677,340 S599G probably damaging Het
Tnc A C 4: 64,017,442 V419G probably damaging Het
Trappc1 C A 11: 69,325,576 P110T probably benign Het
Trbv12-2 C T 6: 41,119,059 probably benign Het
Ttbk2 A T 2: 120,745,783 N835K possibly damaging Het
Tubgcp5 A G 7: 55,800,684 D181G probably damaging Het
Tut1 T C 19: 8,955,527 Y75H possibly damaging Het
Ulk2 C A 11: 61,787,586 C769F probably benign Het
Vdac1 T C 11: 52,374,973 probably benign Het
Vmn2r124 T C 17: 18,064,224 probably null Het
Vps8 T C 16: 21,608,227 probably benign Het
Wdr35 T C 12: 8,995,625 probably benign Het
Zdhhc7 T A 8: 120,086,647 E141V probably null Het
Zfp12 C A 5: 143,245,223 S435Y probably damaging Het
Zfp974 A T 7: 27,927,394 probably benign Het
Zfyve9 T A 4: 108,680,969 K1033N probably damaging Het
Zswim8 T A 14: 20,721,945 S1572T possibly damaging Het
Other mutations in Ccdc180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Ccdc180 APN 4 45900256 missense probably benign
IGL01713:Ccdc180 APN 4 45921025 critical splice donor site probably null
IGL01915:Ccdc180 APN 4 45904544 missense probably damaging 0.98
IGL01935:Ccdc180 APN 4 45906889 missense possibly damaging 0.71
IGL02539:Ccdc180 APN 4 45921005 missense probably damaging 1.00
IGL02982:Ccdc180 APN 4 45903840 splice site probably benign
IGL03071:Ccdc180 APN 4 45903840 splice site probably benign
IGL03146:Ccdc180 APN 4 45903840 splice site probably benign
PIT4687001:Ccdc180 UTSW 4 45949526 missense probably damaging 1.00
R0049:Ccdc180 UTSW 4 45930119 critical splice acceptor site probably null
R0049:Ccdc180 UTSW 4 45930119 critical splice acceptor site probably null
R0054:Ccdc180 UTSW 4 45890900 missense probably benign 0.01
R0054:Ccdc180 UTSW 4 45890900 missense probably benign 0.01
R0080:Ccdc180 UTSW 4 45896205 missense probably null 0.00
R0082:Ccdc180 UTSW 4 45896205 missense probably null 0.00
R0126:Ccdc180 UTSW 4 45912866 critical splice donor site probably null
R0193:Ccdc180 UTSW 4 45914803 missense probably benign 0.01
R0276:Ccdc180 UTSW 4 45923534 missense probably damaging 1.00
R0380:Ccdc180 UTSW 4 45930197 critical splice donor site probably null
R0468:Ccdc180 UTSW 4 45923271 missense possibly damaging 0.87
R0539:Ccdc180 UTSW 4 45922010 missense probably damaging 0.97
R0543:Ccdc180 UTSW 4 45900041 nonsense probably null
R0546:Ccdc180 UTSW 4 45904597 missense possibly damaging 0.71
R0612:Ccdc180 UTSW 4 45927969 missense probably damaging 0.98
R0792:Ccdc180 UTSW 4 45927975 missense possibly damaging 0.92
R1056:Ccdc180 UTSW 4 45916375 missense probably benign 0.01
R1099:Ccdc180 UTSW 4 45914225 missense probably benign 0.03
R1136:Ccdc180 UTSW 4 45914589 missense probably benign 0.00
R1263:Ccdc180 UTSW 4 45903887 missense possibly damaging 0.85
R1331:Ccdc180 UTSW 4 45909359 missense possibly damaging 0.51
R1522:Ccdc180 UTSW 4 45927975 missense possibly damaging 0.92
R1819:Ccdc180 UTSW 4 45926195 missense possibly damaging 0.84
R2022:Ccdc180 UTSW 4 45944418 missense probably benign 0.18
R2056:Ccdc180 UTSW 4 45932477 missense probably benign 0.03
R2219:Ccdc180 UTSW 4 45944949 missense probably damaging 1.00
R2228:Ccdc180 UTSW 4 45948856 critical splice donor site probably null
R2229:Ccdc180 UTSW 4 45948856 critical splice donor site probably null
R2255:Ccdc180 UTSW 4 45921996 missense probably damaging 1.00
R2427:Ccdc180 UTSW 4 45929545 missense probably benign 0.03
R3001:Ccdc180 UTSW 4 45899988 missense probably benign
R3002:Ccdc180 UTSW 4 45899988 missense probably benign
R3003:Ccdc180 UTSW 4 45899988 missense probably benign
R3110:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3111:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3112:Ccdc180 UTSW 4 45900470 missense possibly damaging 0.86
R3898:Ccdc180 UTSW 4 45912799 missense possibly damaging 0.71
R4022:Ccdc180 UTSW 4 45904560 nonsense probably null
R4084:Ccdc180 UTSW 4 45950632 missense probably benign 0.19
R4377:Ccdc180 UTSW 4 45941877 missense probably damaging 1.00
R4595:Ccdc180 UTSW 4 45945023 missense probably damaging 0.98
R4637:Ccdc180 UTSW 4 45914443 missense probably benign
R4811:Ccdc180 UTSW 4 45928020 missense probably damaging 1.00
R4825:Ccdc180 UTSW 4 45912794 missense possibly damaging 0.93
R4858:Ccdc180 UTSW 4 45923244 missense probably damaging 1.00
R4888:Ccdc180 UTSW 4 45909308 missense probably damaging 0.98
R4940:Ccdc180 UTSW 4 45917453 missense probably damaging 0.96
R4940:Ccdc180 UTSW 4 45917508 missense probably damaging 1.00
R5042:Ccdc180 UTSW 4 45916255 missense probably damaging 0.98
R5119:Ccdc180 UTSW 4 45914603 missense possibly damaging 0.72
R5177:Ccdc180 UTSW 4 45917508 missense probably damaging 1.00
R5311:Ccdc180 UTSW 4 45917556 missense probably damaging 1.00
R5333:Ccdc180 UTSW 4 45890935 missense possibly damaging 0.53
R5448:Ccdc180 UTSW 4 45920913 missense probably damaging 1.00
R5510:Ccdc180 UTSW 4 45928046 missense probably damaging 0.96
R6018:Ccdc180 UTSW 4 45926235 missense probably damaging 1.00
R6108:Ccdc180 UTSW 4 45911389 missense possibly damaging 0.71
R6283:Ccdc180 UTSW 4 45902486 missense possibly damaging 0.85
R6483:Ccdc180 UTSW 4 45921950 missense probably benign 0.32
R6618:Ccdc180 UTSW 4 45950708 missense probably damaging 1.00
R7017:Ccdc180 UTSW 4 45940934 missense possibly damaging 0.84
R7205:Ccdc180 UTSW 4 45914588 missense probably benign
R7341:Ccdc180 UTSW 4 45898644 missense possibly damaging 0.85
R7351:Ccdc180 UTSW 4 45903887 missense possibly damaging 0.85
R7418:Ccdc180 UTSW 4 45904616 missense probably damaging 0.98
R7492:Ccdc180 UTSW 4 45930009 splice site probably null
R7573:Ccdc180 UTSW 4 45922015 missense probably benign 0.33
R7639:Ccdc180 UTSW 4 45928043 missense possibly damaging 0.93
R7792:Ccdc180 UTSW 4 45890389 critical splice donor site probably null
R7806:Ccdc180 UTSW 4 45912801 missense possibly damaging 0.85
R7812:Ccdc180 UTSW 4 45906952 critical splice donor site probably null
R7840:Ccdc180 UTSW 4 45900461 missense possibly damaging 0.71
R7842:Ccdc180 UTSW 4 45909428 missense probably benign 0.00
R7923:Ccdc180 UTSW 4 45900461 missense possibly damaging 0.71
R7925:Ccdc180 UTSW 4 45909428 missense probably benign 0.00
X0017:Ccdc180 UTSW 4 45909350 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TCCCCTGAAGAAGTTGAGACGCTG -3'
(R):5'- TCTTCCTGGCTGAGGTATACGGAC -3'

Sequencing Primer
(F):5'- CTGTCACTTCTGAAGAAAGGGC -3'
(R):5'- TGTGCCGGATGTTCACTAGA -3'
Posted On2013-05-09