Incidental Mutation 'R0362:Magi2'
ID36228
Institutional Source Beutler Lab
Gene Symbol Magi2
Ensembl Gene ENSMUSG00000040003
Gene Namemembrane associated guanylate kinase, WW and PDZ domain containing 2
SynonymsMagi-2, S-SCAM, Acvrinp1
MMRRC Submission 038568-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0362 (G1)
Quality Score194
Status Validated
Chromosome5
Chromosomal Location19227036-20704792 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19227575 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 96 (K96R)
Ref Sequence ENSEMBL: ENSMUSP00000142576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088516] [ENSMUST00000197354] [ENSMUST00000197443]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088516
AA Change: K96R

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000085872
Gene: ENSMUSG00000040003
AA Change: K96R

DomainStartEndE-ValueType
PDZ 26 101 5.26e-9 SMART
GuKc 107 290 2.76e-45 SMART
WW 302 334 7.43e-12 SMART
WW 348 380 2.4e-6 SMART
PDZ 433 509 3.51e-19 SMART
PDZ 612 682 2.3e-14 SMART
PDZ 785 861 4.04e-19 SMART
low complexity region 893 907 N/A INTRINSIC
PDZ 928 1009 5.05e-20 SMART
low complexity region 1052 1063 N/A INTRINSIC
PDZ 1147 1221 3.88e-21 SMART
low complexity region 1257 1270 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180594
Predicted Effect probably damaging
Transcript: ENSMUST00000197354
AA Change: K96R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142576
Gene: ENSMUSG00000040003
AA Change: K96R

DomainStartEndE-ValueType
PDZ 26 101 2.5e-11 SMART
GuKc 107 290 1.4e-47 SMART
WW 302 334 4.3e-14 SMART
WW 348 380 1.4e-8 SMART
PDZ 433 509 1.7e-21 SMART
PDZ 612 682 1.1e-16 SMART
PDZ 785 861 2e-21 SMART
low complexity region 893 907 N/A INTRINSIC
PDZ 928 1009 2.4e-22 SMART
low complexity region 1052 1063 N/A INTRINSIC
PDZ 1147 1221 1.9e-23 SMART
low complexity region 1255 1269 N/A INTRINSIC
low complexity region 1304 1319 N/A INTRINSIC
low complexity region 1344 1363 N/A INTRINSIC
low complexity region 1368 1384 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000197443
AA Change: K96R

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142764
Gene: ENSMUSG00000040003
AA Change: K96R

DomainStartEndE-ValueType
PDZ 26 101 2.5e-11 SMART
GuKc 107 290 1.4e-47 SMART
WW 302 334 4.3e-14 SMART
WW 348 380 1.4e-8 SMART
PDZ 433 509 1.7e-21 SMART
PDZ 612 682 1.1e-16 SMART
PDZ 771 847 2e-21 SMART
low complexity region 879 893 N/A INTRINSIC
PDZ 914 995 2.4e-22 SMART
low complexity region 1038 1049 N/A INTRINSIC
PDZ 1133 1207 1.9e-23 SMART
low complexity region 1241 1255 N/A INTRINSIC
low complexity region 1290 1305 N/A INTRINSIC
low complexity region 1330 1349 N/A INTRINSIC
low complexity region 1354 1370 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199384
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200518
Meta Mutation Damage Score 0.3084 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 99% (104/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with atrophin-1. Atrophin-1 contains a polyglutamine repeat, expansion of which is responsible for dentatorubral and pallidoluysian atrophy. This encoded protein is characterized by two WW domains, a guanylate kinase-like domain, and multiple PDZ domains. It has structural similarity to the membrane-associated guanylate kinase homologue (MAGUK) family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show neonatal death and hippocampal neurons with altered dendritic spine morphology. Homozygotes for a different null allele die neonatally due to anuria and podocyte anomalies. Mice lacking all three isoforms develop proteinuria, podocytopathy and die of renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,732,917 Q401R probably benign Het
Acpp A G 9: 104,314,427 F220S probably damaging Het
Adam7 A G 14: 68,509,656 probably benign Het
Adamts6 A G 13: 104,390,076 probably null Het
Ascc3 T C 10: 50,748,955 probably benign Het
Atg10 T C 13: 91,040,990 probably null Het
Atm T C 9: 53,458,838 I2325V possibly damaging Het
Btnl9 C T 11: 49,169,616 R435H possibly damaging Het
Ccdc180 A G 4: 45,923,551 K1111E probably damaging Het
Col11a2 T A 17: 34,062,446 probably null Het
Ctcfl A G 2: 173,118,443 W116R probably damaging Het
Ctsk A T 3: 95,500,944 Y37F probably damaging Het
Daam2 G C 17: 49,480,785 probably null Het
Dcdc2b T C 4: 129,610,238 probably null Het
Ddx28 C T 8: 106,011,294 R44Q probably damaging Het
Dhx29 T A 13: 112,962,859 N1139K probably benign Het
Dnah17 A T 11: 118,098,539 M1281K probably benign Het
Dnah6 T C 6: 73,208,609 S110G probably benign Het
Drc7 T C 8: 95,072,855 Y553H probably benign Het
Dync2h1 T C 9: 7,005,487 probably null Het
Ecm1 A G 3: 95,737,057 I152T possibly damaging Het
Edc4 C G 8: 105,886,775 P307R probably damaging Het
Egr1 A G 18: 34,863,313 T383A possibly damaging Het
Eml2 A G 7: 19,190,806 probably null Het
Eno4 A G 19: 58,943,624 probably benign Het
Erbb4 A T 1: 68,330,270 I404K probably damaging Het
Exoc7 G T 11: 116,295,662 T310K probably benign Het
Fam102b C T 3: 108,980,181 E256K probably benign Het
Fam83e G T 7: 45,726,969 V369L probably benign Het
Fam96b T C 8: 104,641,590 D34G probably null Het
Fancc A T 13: 63,398,156 I91K possibly damaging Het
Fbn1 T C 2: 125,309,777 Q2519R probably damaging Het
Fhod3 T A 18: 25,090,076 C826* probably null Het
Foxi3 A G 6: 70,956,628 D33G probably benign Het
Gcn1l1 T C 5: 115,576,108 probably benign Het
Gm14221 T C 2: 160,568,390 noncoding transcript Het
Golga4 T A 9: 118,555,785 H630Q probably benign Het
Gpat4 T C 8: 23,180,933 S88G probably benign Het
Gucy2d A T 7: 98,443,685 S90C probably damaging Het
Has2 A C 15: 56,681,661 C182G probably damaging Het
Heatr5a A T 12: 51,888,861 S1647R probably damaging Het
Ifi35 T C 11: 101,457,212 V48A probably benign Het
Lig1 T A 7: 13,296,804 probably benign Het
Map7d1 G T 4: 126,234,994 P462Q probably damaging Het
Mdn1 A T 4: 32,746,439 probably null Het
Mfsd4a A T 1: 132,059,275 V105E probably damaging Het
Mrpl53 C T 6: 83,109,545 R77C probably damaging Het
Mtnr1b C T 9: 15,874,304 V53M probably damaging Het
Myo9b T C 8: 71,347,770 W990R probably damaging Het
Myt1 A T 2: 181,763,393 probably benign Het
Nf1 C T 11: 79,536,878 A1766V probably damaging Het
Nlrp3 T C 11: 59,548,797 V400A possibly damaging Het
Nup205 T A 6: 35,196,714 probably null Het
Nxf1 T C 19: 8,764,151 probably null Het
Olfr1352 A T 10: 78,984,386 M199L probably benign Het
P4hb T C 11: 120,563,336 K311E probably benign Het
Pafah1b1 T C 11: 74,683,631 N243S probably benign Het
Parp8 G A 13: 116,924,968 Q141* probably null Het
Pkd2l2 A C 18: 34,435,327 D543A probably benign Het
Pld5 A T 1: 175,975,580 L311* probably null Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plpp5 A T 8: 25,724,192 T144S probably benign Het
Ppp6r3 A G 19: 3,478,285 L542S probably damaging Het
Prkar2b A T 12: 31,987,974 probably null Het
Psmg1 A T 16: 95,987,971 S129T possibly damaging Het
Radil T C 5: 142,543,827 D38G probably benign Het
Ric1 T C 19: 29,601,011 probably null Het
Rp1l1 T A 14: 64,031,066 L1367* probably null Het
Rxfp1 A T 3: 79,737,793 M1K probably null Het
Serpina6 G T 12: 103,651,949 L202I probably damaging Het
Simc1 T C 13: 54,528,467 I98T probably damaging Het
Slc17a6 A G 7: 51,658,771 Y281C probably damaging Het
Slc26a11 T A 11: 119,379,941 probably benign Het
Slc34a1 T A 13: 55,402,898 probably null Het
Slfn10-ps T A 11: 83,035,774 noncoding transcript Het
Sohlh2 A G 3: 55,207,742 N383D probably damaging Het
Spag6 T A 2: 18,710,491 L27H probably damaging Het
Sptlc3 A G 2: 139,546,555 probably benign Het
St3gal4 T A 9: 35,053,173 K199* probably null Het
Stat5a T A 11: 100,882,083 D712E probably benign Het
Stmn2 A T 3: 8,545,690 D78V probably damaging Het
Stpg1 C T 4: 135,506,466 P20S possibly damaging Het
Taf2 A T 15: 55,045,929 V640E probably damaging Het
Tbce T C 13: 13,998,162 E501G probably benign Het
Tecpr2 A G 12: 110,968,940 S1398G probably damaging Het
Tenm4 T A 7: 96,772,035 Y598* probably null Het
Ticrr A G 7: 79,677,340 S599G probably damaging Het
Tnc A C 4: 64,017,442 V419G probably damaging Het
Trappc1 C A 11: 69,325,576 P110T probably benign Het
Trbv12-2 C T 6: 41,119,059 probably benign Het
Ttbk2 A T 2: 120,745,783 N835K possibly damaging Het
Tubgcp5 A G 7: 55,800,684 D181G probably damaging Het
Tut1 T C 19: 8,955,527 Y75H possibly damaging Het
Ulk2 C A 11: 61,787,586 C769F probably benign Het
Vdac1 T C 11: 52,374,973 probably benign Het
Vmn2r124 T C 17: 18,064,224 probably null Het
Vps8 T C 16: 21,608,227 probably benign Het
Wdr35 T C 12: 8,995,625 probably benign Het
Zdhhc7 T A 8: 120,086,647 E141V probably null Het
Zfp12 C A 5: 143,245,223 S435Y probably damaging Het
Zfp974 A T 7: 27,927,394 probably benign Het
Zfyve9 T A 4: 108,680,969 K1033N probably damaging Het
Zswim8 T A 14: 20,721,945 S1572T possibly damaging Het
Other mutations in Magi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Magi2 APN 5 20391301 missense probably benign 0.05
IGL02120:Magi2 APN 5 20228453 critical splice donor site probably null
IGL02341:Magi2 APN 5 20466203 missense probably damaging 1.00
IGL02411:Magi2 APN 5 19678709 missense probably damaging 1.00
IGL02657:Magi2 APN 5 19227583 missense probably damaging 0.99
IGL02976:Magi2 APN 5 20534475 missense probably damaging 1.00
IGL03105:Magi2 APN 5 20543618 missense probably damaging 0.97
IGL03246:Magi2 APN 5 20358950 missense probably damaging 1.00
IGL03329:Magi2 APN 5 20466128 missense possibly damaging 0.95
LCD18:Magi2 UTSW 5 19954511 intron probably benign
PIT4519001:Magi2 UTSW 5 20661346 missense probably damaging 1.00
R0009:Magi2 UTSW 5 20611055 missense probably benign 0.15
R0009:Magi2 UTSW 5 20611055 missense probably benign 0.15
R0352:Magi2 UTSW 5 20065666 missense probably damaging 1.00
R0496:Magi2 UTSW 5 20661359 splice site probably benign
R1103:Magi2 UTSW 5 20611103 missense probably damaging 1.00
R1435:Magi2 UTSW 5 20358945 missense probably damaging 1.00
R1583:Magi2 UTSW 5 19227332 missense probably benign 0.30
R1616:Magi2 UTSW 5 20609326 missense probably damaging 1.00
R1643:Magi2 UTSW 5 20705506 unclassified probably benign
R1707:Magi2 UTSW 5 20215493 missense probably damaging 1.00
R1833:Magi2 UTSW 5 19227457 missense probably damaging 1.00
R1837:Magi2 UTSW 5 20465827 missense probably damaging 1.00
R1838:Magi2 UTSW 5 20465827 missense probably damaging 1.00
R1839:Magi2 UTSW 5 20465827 missense probably damaging 1.00
R1847:Magi2 UTSW 5 20602460 missense probably damaging 0.99
R2223:Magi2 UTSW 5 20465672 missense probably damaging 1.00
R2496:Magi2 UTSW 5 19678752 missense probably benign 0.42
R2504:Magi2 UTSW 5 20358936 missense probably damaging 1.00
R2848:Magi2 UTSW 5 20602461 frame shift probably null
R2879:Magi2 UTSW 5 20602461 frame shift probably null
R2935:Magi2 UTSW 5 20602461 frame shift probably null
R2936:Magi2 UTSW 5 20602461 frame shift probably null
R3694:Magi2 UTSW 5 20602461 frame shift probably null
R3783:Magi2 UTSW 5 20465909 missense probably damaging 0.97
R3786:Magi2 UTSW 5 20465909 missense probably damaging 0.97
R3787:Magi2 UTSW 5 20465909 missense probably damaging 0.97
R3837:Magi2 UTSW 5 20215468 missense probably benign 0.28
R4151:Magi2 UTSW 5 19227292 missense probably damaging 0.97
R4721:Magi2 UTSW 5 20534469 missense probably damaging 1.00
R5005:Magi2 UTSW 5 20534446 missense probably damaging 0.98
R5012:Magi2 UTSW 5 20465620 missense probably damaging 0.99
R5193:Magi2 UTSW 5 20358972 critical splice donor site probably null
R5298:Magi2 UTSW 5 20569162 missense probably damaging 1.00
R5372:Magi2 UTSW 5 20702110 missense possibly damaging 0.82
R5580:Magi2 UTSW 5 20215424 missense probably benign 0.03
R5806:Magi2 UTSW 5 20651204 missense probably benign 0.01
R5924:Magi2 UTSW 5 20611069 missense probably benign 0.00
R5992:Magi2 UTSW 5 19227291 start codon destroyed probably null 0.42
R6014:Magi2 UTSW 5 20611093 missense probably damaging 1.00
R6073:Magi2 UTSW 5 20569288 missense probably damaging 1.00
R6500:Magi2 UTSW 5 20602347 missense possibly damaging 0.94
R6664:Magi2 UTSW 5 20702397 missense probably benign 0.00
R7229:Magi2 UTSW 5 20465588 missense probably damaging 1.00
R7344:Magi2 UTSW 5 20550240 missense probably benign 0.19
R7448:Magi2 UTSW 5 20358956 missense probably damaging 1.00
R7605:Magi2 UTSW 5 20228385 missense probably damaging 1.00
R7712:Magi2 UTSW 5 20550282 missense possibly damaging 0.78
R7808:Magi2 UTSW 5 20465840 missense probably benign 0.03
X0065:Magi2 UTSW 5 20569178 missense possibly damaging 0.94
Z1176:Magi2 UTSW 5 20702109 missense probably benign 0.32
Z1177:Magi2 UTSW 5 20702412 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACTAGCAAAGTCCACGAGAGTGTC -3'
(R):5'- CTAAGTTGCCTGCTACAGTACCACC -3'

Sequencing Primer
(F):5'- AGTGTCATTGGCAGGAACCC -3'
(R):5'- GCTACAGTACCACCTGGCTTAG -3'
Posted On2013-05-09