Incidental Mutation 'R0362:Eml2'
ID 36238
Institutional Source Beutler Lab
Gene Symbol Eml2
Ensembl Gene ENSMUSG00000040811
Gene Name echinoderm microtubule associated protein like 2
Synonyms 1600029N02Rik
MMRRC Submission 038568-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0362 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 19176421-19206482 bp(+) (GRCm38)
Type of Mutation splice site (4448 bp from exon)
DNA Base Change (assembly) A to G at 19190806 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048502] [ENSMUST00000117338] [ENSMUST00000120595] [ENSMUST00000141718] [ENSMUST00000148246]
AlphaFold Q7TNG5
Predicted Effect possibly damaging
Transcript: ENSMUST00000048502
AA Change: D219G

PolyPhen 2 Score 0.453 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000037654
Gene: ENSMUSG00000040811
AA Change: D219G

DomainStartEndE-ValueType
Pfam:HELP 17 65 4.6e-14 PFAM
WD40 113 162 8.36e-2 SMART
WD40 165 210 9.21e0 SMART
WD40 213 252 7.99e-1 SMART
WD40 258 298 3.7e0 SMART
WD40 301 341 3.58e-1 SMART
WD40 385 424 5.52e-2 SMART
WD40 427 465 1.1e1 SMART
WD40 468 507 4.95e-4 SMART
WD40 514 553 4.62e-4 SMART
WD40 579 620 4.75e1 SMART
WD40 626 666 2.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117338
AA Change: D392G

PolyPhen 2 Score 0.324 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112491
Gene: ENSMUSG00000040811
AA Change: D392G

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
coiled coil region 59 106 N/A INTRINSIC
low complexity region 183 191 N/A INTRINSIC
Pfam:HELP 211 285 3.5e-29 PFAM
WD40 286 335 5.5e-4 SMART
WD40 338 383 5.8e-2 SMART
WD40 386 425 5.2e-3 SMART
WD40 431 471 2.4e-2 SMART
WD40 474 514 2.3e-3 SMART
WD40 558 597 3.6e-4 SMART
WD40 600 638 7.1e-2 SMART
WD40 641 680 3.1e-6 SMART
WD40 687 726 3.1e-6 SMART
WD40 752 793 3e-1 SMART
WD40 799 839 1.7e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000120595
AA Change: D200G

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000112447
Gene: ENSMUSG00000040811
AA Change: D200G

DomainStartEndE-ValueType
WD40 94 154 2.48e0 SMART
WD40 157 196 7.99e-1 SMART
WD40 202 242 3.7e0 SMART
WD40 245 285 3.58e-1 SMART
WD40 329 368 5.52e-2 SMART
WD40 371 409 1.1e1 SMART
WD40 412 451 4.95e-4 SMART
WD40 458 497 4.62e-4 SMART
WD40 523 564 4.75e1 SMART
WD40 570 610 2.67e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000141718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146095
Predicted Effect probably benign
Transcript: ENSMUST00000148246
AA Change: D200G

PolyPhen 2 Score 0.201 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000115466
Gene: ENSMUSG00000040811
AA Change: D200G

DomainStartEndE-ValueType
WD40 94 143 8.36e-2 SMART
WD40 146 191 9.21e0 SMART
WD40 194 233 7.99e-1 SMART
WD40 239 279 3.7e0 SMART
WD40 282 322 3.58e-1 SMART
WD40 366 405 5.52e-2 SMART
Meta Mutation Damage Score 0.6421 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 99% (104/105)
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,732,917 Q401R probably benign Het
Acpp A G 9: 104,314,427 F220S probably damaging Het
Adam7 A G 14: 68,509,656 probably benign Het
Adamts6 A G 13: 104,390,076 probably null Het
Ascc3 T C 10: 50,748,955 probably benign Het
Atg10 T C 13: 91,040,990 probably null Het
Atm T C 9: 53,458,838 I2325V possibly damaging Het
Btnl9 C T 11: 49,169,616 R435H possibly damaging Het
Ccdc180 A G 4: 45,923,551 K1111E probably damaging Het
Col11a2 T A 17: 34,062,446 probably null Het
Ctcfl A G 2: 173,118,443 W116R probably damaging Het
Ctsk A T 3: 95,500,944 Y37F probably damaging Het
Daam2 G C 17: 49,480,785 probably null Het
Dcdc2b T C 4: 129,610,238 probably null Het
Ddx28 C T 8: 106,011,294 R44Q probably damaging Het
Dhx29 T A 13: 112,962,859 N1139K probably benign Het
Dnah17 A T 11: 118,098,539 M1281K probably benign Het
Dnah6 T C 6: 73,208,609 S110G probably benign Het
Drc7 T C 8: 95,072,855 Y553H probably benign Het
Dync2h1 T C 9: 7,005,487 probably null Het
Ecm1 A G 3: 95,737,057 I152T possibly damaging Het
Edc4 C G 8: 105,886,775 P307R probably damaging Het
Egr1 A G 18: 34,863,313 T383A possibly damaging Het
Eno4 A G 19: 58,943,624 probably benign Het
Erbb4 A T 1: 68,330,270 I404K probably damaging Het
Exoc7 G T 11: 116,295,662 T310K probably benign Het
Fam102b C T 3: 108,980,181 E256K probably benign Het
Fam83e G T 7: 45,726,969 V369L probably benign Het
Fam96b T C 8: 104,641,590 D34G probably null Het
Fancc A T 13: 63,398,156 I91K possibly damaging Het
Fbn1 T C 2: 125,309,777 Q2519R probably damaging Het
Fhod3 T A 18: 25,090,076 C826* probably null Het
Foxi3 A G 6: 70,956,628 D33G probably benign Het
Gcn1l1 T C 5: 115,576,108 probably benign Het
Gm14221 T C 2: 160,568,390 noncoding transcript Het
Golga4 T A 9: 118,555,785 H630Q probably benign Het
Gpat4 T C 8: 23,180,933 S88G probably benign Het
Gucy2d A T 7: 98,443,685 S90C probably damaging Het
Has2 A C 15: 56,681,661 C182G probably damaging Het
Heatr5a A T 12: 51,888,861 S1647R probably damaging Het
Ifi35 T C 11: 101,457,212 V48A probably benign Het
Lig1 T A 7: 13,296,804 probably benign Het
Magi2 A G 5: 19,227,575 K96R probably damaging Het
Map7d1 G T 4: 126,234,994 P462Q probably damaging Het
Mdn1 A T 4: 32,746,439 probably null Het
Mfsd4a A T 1: 132,059,275 V105E probably damaging Het
Mrpl53 C T 6: 83,109,545 R77C probably damaging Het
Mtnr1b C T 9: 15,874,304 V53M probably damaging Het
Myo9b T C 8: 71,347,770 W990R probably damaging Het
Myt1 A T 2: 181,763,393 probably benign Het
Nf1 C T 11: 79,536,878 A1766V probably damaging Het
Nlrp3 T C 11: 59,548,797 V400A possibly damaging Het
Nup205 T A 6: 35,196,714 probably null Het
Nxf1 T C 19: 8,764,151 probably null Het
Olfr1352 A T 10: 78,984,386 M199L probably benign Het
P4hb T C 11: 120,563,336 K311E probably benign Het
Pafah1b1 T C 11: 74,683,631 N243S probably benign Het
Parp8 G A 13: 116,924,968 Q141* probably null Het
Pkd2l2 A C 18: 34,435,327 D543A probably benign Het
Pld5 A T 1: 175,975,580 L311* probably null Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plpp5 A T 8: 25,724,192 T144S probably benign Het
Ppp6r3 A G 19: 3,478,285 L542S probably damaging Het
Prkar2b A T 12: 31,987,974 probably null Het
Psmg1 A T 16: 95,987,971 S129T possibly damaging Het
Radil T C 5: 142,543,827 D38G probably benign Het
Ric1 T C 19: 29,601,011 probably null Het
Rp1l1 T A 14: 64,031,066 L1367* probably null Het
Rxfp1 A T 3: 79,737,793 M1K probably null Het
Serpina6 G T 12: 103,651,949 L202I probably damaging Het
Simc1 T C 13: 54,528,467 I98T probably damaging Het
Slc17a6 A G 7: 51,658,771 Y281C probably damaging Het
Slc26a11 T A 11: 119,379,941 probably benign Het
Slc34a1 T A 13: 55,402,898 probably null Het
Slfn10-ps T A 11: 83,035,774 noncoding transcript Het
Sohlh2 A G 3: 55,207,742 N383D probably damaging Het
Spag6 T A 2: 18,710,491 L27H probably damaging Het
Sptlc3 A G 2: 139,546,555 probably benign Het
St3gal4 T A 9: 35,053,173 K199* probably null Het
Stat5a T A 11: 100,882,083 D712E probably benign Het
Stmn2 A T 3: 8,545,690 D78V probably damaging Het
Stpg1 C T 4: 135,506,466 P20S possibly damaging Het
Taf2 A T 15: 55,045,929 V640E probably damaging Het
Tbce T C 13: 13,998,162 E501G probably benign Het
Tecpr2 A G 12: 110,968,940 S1398G probably damaging Het
Tenm4 T A 7: 96,772,035 Y598* probably null Het
Ticrr A G 7: 79,677,340 S599G probably damaging Het
Tnc A C 4: 64,017,442 V419G probably damaging Het
Trappc1 C A 11: 69,325,576 P110T probably benign Het
Trbv12-2 C T 6: 41,119,059 probably benign Het
Ttbk2 A T 2: 120,745,783 N835K possibly damaging Het
Tubgcp5 A G 7: 55,800,684 D181G probably damaging Het
Tut1 T C 19: 8,955,527 Y75H possibly damaging Het
Ulk2 C A 11: 61,787,586 C769F probably benign Het
Vdac1 T C 11: 52,374,973 probably benign Het
Vmn2r124 T C 17: 18,064,224 probably null Het
Vps8 T C 16: 21,608,227 probably benign Het
Wdr35 T C 12: 8,995,625 probably benign Het
Zdhhc7 T A 8: 120,086,647 E141V probably null Het
Zfp12 C A 5: 143,245,223 S435Y probably damaging Het
Zfp974 A T 7: 27,927,394 probably benign Het
Zfyve9 T A 4: 108,680,969 K1033N probably damaging Het
Zswim8 T A 14: 20,721,945 S1572T possibly damaging Het
Other mutations in Eml2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Eml2 APN 7 19206143 missense probably damaging 1.00
IGL00786:Eml2 APN 7 19202582 missense probably damaging 1.00
IGL01084:Eml2 APN 7 19190738 nonsense probably null
IGL01132:Eml2 APN 7 19200539 missense probably damaging 1.00
IGL01678:Eml2 APN 7 19186122 missense probably benign 0.38
IGL01800:Eml2 APN 7 19201197 intron probably benign
IGL02517:Eml2 APN 7 19206130 missense probably damaging 1.00
IGL02607:Eml2 APN 7 19206111 missense probably damaging 1.00
IGL02676:Eml2 APN 7 19184921 nonsense probably null
IGL03082:Eml2 APN 7 19201877 missense probably damaging 1.00
puffery UTSW 7 19201163 missense probably damaging 1.00
R0628_Eml2_697 UTSW 7 19201554 splice site probably benign
R0040:Eml2 UTSW 7 19196614 missense possibly damaging 0.48
R0135:Eml2 UTSW 7 19203952 missense probably damaging 1.00
R0240:Eml2 UTSW 7 19184872 nonsense probably null
R0240:Eml2 UTSW 7 19184872 nonsense probably null
R0387:Eml2 UTSW 7 19182259 splice site probably null
R0432:Eml2 UTSW 7 19179531 nonsense probably null
R0614:Eml2 UTSW 7 19202591 missense probably damaging 1.00
R0628:Eml2 UTSW 7 19201554 splice site probably benign
R1078:Eml2 UTSW 7 19179762 missense probably benign 0.24
R1531:Eml2 UTSW 7 19196254 missense probably damaging 1.00
R1856:Eml2 UTSW 7 19194061 missense probably damaging 0.97
R1864:Eml2 UTSW 7 19201878 missense probably damaging 1.00
R1937:Eml2 UTSW 7 19203964 missense possibly damaging 0.68
R2032:Eml2 UTSW 7 19202555 missense probably benign 0.03
R2185:Eml2 UTSW 7 19194028 missense probably damaging 1.00
R2419:Eml2 UTSW 7 19176695 unclassified probably benign
R3821:Eml2 UTSW 7 19202986 missense possibly damaging 0.94
R4199:Eml2 UTSW 7 19179439 missense probably benign 0.00
R4411:Eml2 UTSW 7 19182401 critical splice donor site probably null
R4497:Eml2 UTSW 7 19179350 missense probably damaging 1.00
R4885:Eml2 UTSW 7 19204010 missense probably benign 0.05
R4912:Eml2 UTSW 7 19193999 splice site probably null
R5028:Eml2 UTSW 7 19179447 critical splice donor site probably null
R5192:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5196:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5373:Eml2 UTSW 7 19179263 missense possibly damaging 0.92
R5718:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5719:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5720:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5727:Eml2 UTSW 7 19190760 missense probably damaging 0.99
R5841:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5842:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5843:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R5844:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6014:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6015:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6017:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6073:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6075:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6126:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6128:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6129:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6189:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6190:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6258:Eml2 UTSW 7 19179364 splice site probably null
R6273:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6289:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6376:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6378:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6381:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6384:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6394:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6435:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6436:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6437:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6476:Eml2 UTSW 7 19196311 missense probably benign 0.26
R6550:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6551:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6552:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6554:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6572:Eml2 UTSW 7 19196614 missense possibly damaging 0.48
R6598:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6599:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6704:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6705:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6709:Eml2 UTSW 7 19206211 makesense probably null
R6730:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6734:Eml2 UTSW 7 19200507 missense probably benign 0.35
R6742:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6769:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6770:Eml2 UTSW 7 19201163 missense probably damaging 1.00
R6864:Eml2 UTSW 7 19196281 missense probably damaging 0.99
R6878:Eml2 UTSW 7 19200612 missense probably benign 0.08
R7045:Eml2 UTSW 7 19201579 missense probably damaging 1.00
R7260:Eml2 UTSW 7 19200590 missense probably benign 0.45
R7478:Eml2 UTSW 7 19206141 nonsense probably null
R7706:Eml2 UTSW 7 19186110 missense possibly damaging 0.79
R7811:Eml2 UTSW 7 19186122 missense probably benign 0.38
R8084:Eml2 UTSW 7 19181224 critical splice donor site probably null
R8337:Eml2 UTSW 7 19196236 missense possibly damaging 0.84
R8414:Eml2 UTSW 7 19179295 missense probably damaging 1.00
R8868:Eml2 UTSW 7 19194063 missense probably benign 0.03
R8934:Eml2 UTSW 7 19179813 missense probably damaging 0.99
R9110:Eml2 UTSW 7 19191695 missense probably benign 0.07
R9131:Eml2 UTSW 7 19184826 missense
R9144:Eml2 UTSW 7 19201639 missense possibly damaging 0.75
R9261:Eml2 UTSW 7 19179818 missense probably benign 0.45
R9285:Eml2 UTSW 7 19191643 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTTGTGAATAGGCAGGTGTGGTGAA -3'
(R):5'- CCACCCAACCCCTGATGACTCTT -3'

Sequencing Primer
(F):5'- CAGGTGTGGTGAATAGGTTAGAATG -3'
(R):5'- actcaacctctccacctcc -3'
Posted On 2013-05-09