Incidental Mutation 'R0362:Zfp974'
ID36239
Institutional Source Beutler Lab
Gene Symbol Zfp974
Ensembl Gene ENSMUSG00000070709
Gene Namezinc finger protein 974
Synonyms1700049G17Rik
MMRRC Submission 038568-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R0362 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location27907392-27929460 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 27927394 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098639] [ENSMUST00000129341]
Predicted Effect probably benign
Transcript: ENSMUST00000098639
SMART Domains Protein: ENSMUSP00000096238
Gene: ENSMUSG00000070709

DomainStartEndE-ValueType
ZnF_C2H2 99 121 8.81e-2 SMART
ZnF_C2H2 127 149 1.82e-3 SMART
ZnF_C2H2 155 177 3.11e-2 SMART
ZnF_C2H2 201 223 2.15e-5 SMART
ZnF_C2H2 229 251 1.18e-2 SMART
ZnF_C2H2 257 279 1.47e-3 SMART
ZnF_C2H2 285 307 1.79e-2 SMART
ZnF_C2H2 313 335 2.24e-3 SMART
ZnF_C2H2 341 363 9.73e-4 SMART
ZnF_C2H2 369 391 7.26e-3 SMART
ZnF_C2H2 397 419 6.42e-4 SMART
ZnF_C2H2 425 447 3.63e-3 SMART
ZnF_C2H2 453 475 1.28e-3 SMART
ZnF_C2H2 481 503 1.26e-2 SMART
ZnF_C2H2 509 531 1.38e-3 SMART
ZnF_C2H2 537 559 3.83e-2 SMART
ZnF_C2H2 565 587 1.95e-3 SMART
ZnF_C2H2 593 615 4.61e-5 SMART
ZnF_C2H2 621 643 1.95e-3 SMART
ZnF_C2H2 649 671 1.03e-2 SMART
ZnF_C2H2 677 699 5.5e-3 SMART
ZnF_C2H2 705 727 2.37e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129341
SMART Domains Protein: ENSMUSP00000115940
Gene: ENSMUSG00000070709

DomainStartEndE-ValueType
KRAB 14 75 7.5e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138583
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181644
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 99% (104/105)
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,732,917 Q401R probably benign Het
Acpp A G 9: 104,314,427 F220S probably damaging Het
Adam7 A G 14: 68,509,656 probably benign Het
Adamts6 A G 13: 104,390,076 probably null Het
Ascc3 T C 10: 50,748,955 probably benign Het
Atg10 T C 13: 91,040,990 probably null Het
Atm T C 9: 53,458,838 I2325V possibly damaging Het
Btnl9 C T 11: 49,169,616 R435H possibly damaging Het
Ccdc180 A G 4: 45,923,551 K1111E probably damaging Het
Col11a2 T A 17: 34,062,446 probably null Het
Ctcfl A G 2: 173,118,443 W116R probably damaging Het
Ctsk A T 3: 95,500,944 Y37F probably damaging Het
Daam2 G C 17: 49,480,785 probably null Het
Dcdc2b T C 4: 129,610,238 probably null Het
Ddx28 C T 8: 106,011,294 R44Q probably damaging Het
Dhx29 T A 13: 112,962,859 N1139K probably benign Het
Dnah17 A T 11: 118,098,539 M1281K probably benign Het
Dnah6 T C 6: 73,208,609 S110G probably benign Het
Drc7 T C 8: 95,072,855 Y553H probably benign Het
Dync2h1 T C 9: 7,005,487 probably null Het
Ecm1 A G 3: 95,737,057 I152T possibly damaging Het
Edc4 C G 8: 105,886,775 P307R probably damaging Het
Egr1 A G 18: 34,863,313 T383A possibly damaging Het
Eml2 A G 7: 19,190,806 probably null Het
Eno4 A G 19: 58,943,624 probably benign Het
Erbb4 A T 1: 68,330,270 I404K probably damaging Het
Exoc7 G T 11: 116,295,662 T310K probably benign Het
Fam102b C T 3: 108,980,181 E256K probably benign Het
Fam83e G T 7: 45,726,969 V369L probably benign Het
Fam96b T C 8: 104,641,590 D34G probably null Het
Fancc A T 13: 63,398,156 I91K possibly damaging Het
Fbn1 T C 2: 125,309,777 Q2519R probably damaging Het
Fhod3 T A 18: 25,090,076 C826* probably null Het
Foxi3 A G 6: 70,956,628 D33G probably benign Het
Gcn1l1 T C 5: 115,576,108 probably benign Het
Gm14221 T C 2: 160,568,390 noncoding transcript Het
Golga4 T A 9: 118,555,785 H630Q probably benign Het
Gpat4 T C 8: 23,180,933 S88G probably benign Het
Gucy2d A T 7: 98,443,685 S90C probably damaging Het
Has2 A C 15: 56,681,661 C182G probably damaging Het
Heatr5a A T 12: 51,888,861 S1647R probably damaging Het
Ifi35 T C 11: 101,457,212 V48A probably benign Het
Lig1 T A 7: 13,296,804 probably benign Het
Magi2 A G 5: 19,227,575 K96R probably damaging Het
Map7d1 G T 4: 126,234,994 P462Q probably damaging Het
Mdn1 A T 4: 32,746,439 probably null Het
Mfsd4a A T 1: 132,059,275 V105E probably damaging Het
Mrpl53 C T 6: 83,109,545 R77C probably damaging Het
Mtnr1b C T 9: 15,874,304 V53M probably damaging Het
Myo9b T C 8: 71,347,770 W990R probably damaging Het
Myt1 A T 2: 181,763,393 probably benign Het
Nf1 C T 11: 79,536,878 A1766V probably damaging Het
Nlrp3 T C 11: 59,548,797 V400A possibly damaging Het
Nup205 T A 6: 35,196,714 probably null Het
Nxf1 T C 19: 8,764,151 probably null Het
Olfr1352 A T 10: 78,984,386 M199L probably benign Het
P4hb T C 11: 120,563,336 K311E probably benign Het
Pafah1b1 T C 11: 74,683,631 N243S probably benign Het
Parp8 G A 13: 116,924,968 Q141* probably null Het
Pkd2l2 A C 18: 34,435,327 D543A probably benign Het
Pld5 A T 1: 175,975,580 L311* probably null Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plpp5 A T 8: 25,724,192 T144S probably benign Het
Ppp6r3 A G 19: 3,478,285 L542S probably damaging Het
Prkar2b A T 12: 31,987,974 probably null Het
Psmg1 A T 16: 95,987,971 S129T possibly damaging Het
Radil T C 5: 142,543,827 D38G probably benign Het
Ric1 T C 19: 29,601,011 probably null Het
Rp1l1 T A 14: 64,031,066 L1367* probably null Het
Rxfp1 A T 3: 79,737,793 M1K probably null Het
Serpina6 G T 12: 103,651,949 L202I probably damaging Het
Simc1 T C 13: 54,528,467 I98T probably damaging Het
Slc17a6 A G 7: 51,658,771 Y281C probably damaging Het
Slc26a11 T A 11: 119,379,941 probably benign Het
Slc34a1 T A 13: 55,402,898 probably null Het
Slfn10-ps T A 11: 83,035,774 noncoding transcript Het
Sohlh2 A G 3: 55,207,742 N383D probably damaging Het
Spag6 T A 2: 18,710,491 L27H probably damaging Het
Sptlc3 A G 2: 139,546,555 probably benign Het
St3gal4 T A 9: 35,053,173 K199* probably null Het
Stat5a T A 11: 100,882,083 D712E probably benign Het
Stmn2 A T 3: 8,545,690 D78V probably damaging Het
Stpg1 C T 4: 135,506,466 P20S possibly damaging Het
Taf2 A T 15: 55,045,929 V640E probably damaging Het
Tbce T C 13: 13,998,162 E501G probably benign Het
Tecpr2 A G 12: 110,968,940 S1398G probably damaging Het
Tenm4 T A 7: 96,772,035 Y598* probably null Het
Ticrr A G 7: 79,677,340 S599G probably damaging Het
Tnc A C 4: 64,017,442 V419G probably damaging Het
Trappc1 C A 11: 69,325,576 P110T probably benign Het
Trbv12-2 C T 6: 41,119,059 probably benign Het
Ttbk2 A T 2: 120,745,783 N835K possibly damaging Het
Tubgcp5 A G 7: 55,800,684 D181G probably damaging Het
Tut1 T C 19: 8,955,527 Y75H possibly damaging Het
Ulk2 C A 11: 61,787,586 C769F probably benign Het
Vdac1 T C 11: 52,374,973 probably benign Het
Vmn2r124 T C 17: 18,064,224 probably null Het
Vps8 T C 16: 21,608,227 probably benign Het
Wdr35 T C 12: 8,995,625 probably benign Het
Zdhhc7 T A 8: 120,086,647 E141V probably null Het
Zfp12 C A 5: 143,245,223 S435Y probably damaging Het
Zfyve9 T A 4: 108,680,969 K1033N probably damaging Het
Zswim8 T A 14: 20,721,945 S1572T possibly damaging Het
Other mutations in Zfp974
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Zfp974 APN 7 27910890 missense possibly damaging 0.83
IGL01805:Zfp974 APN 7 27912264 splice site probably benign
IGL02313:Zfp974 APN 7 27912253 missense possibly damaging 0.53
IGL02449:Zfp974 APN 7 27911727 missense probably benign
R0372:Zfp974 UTSW 7 27920695 critical splice donor site probably null
R0379:Zfp974 UTSW 7 27910932 missense probably damaging 0.98
R0699:Zfp974 UTSW 7 27911991 missense possibly damaging 0.56
R0791:Zfp974 UTSW 7 27910085 nonsense probably null
R1411:Zfp974 UTSW 7 27911209 missense probably benign 0.00
R1567:Zfp974 UTSW 7 27910723 missense probably damaging 0.99
R1747:Zfp974 UTSW 7 27911081 missense possibly damaging 0.61
R1837:Zfp974 UTSW 7 27910356 missense possibly damaging 0.93
R1838:Zfp974 UTSW 7 27910356 missense possibly damaging 0.93
R1839:Zfp974 UTSW 7 27910356 missense possibly damaging 0.93
R2311:Zfp974 UTSW 7 27910441 missense possibly damaging 0.73
R4006:Zfp974 UTSW 7 27912252 missense possibly damaging 0.86
R4303:Zfp974 UTSW 7 27910232 missense possibly damaging 0.85
R4541:Zfp974 UTSW 7 27926404 missense probably damaging 0.99
R4771:Zfp974 UTSW 7 27926308 missense probably damaging 0.96
R4889:Zfp974 UTSW 7 27910819 missense possibly damaging 0.86
R5332:Zfp974 UTSW 7 27926290 missense probably benign 0.01
R5537:Zfp974 UTSW 7 27912246 critical splice acceptor site probably benign
R5906:Zfp974 UTSW 7 27910805 missense possibly damaging 0.72
R5908:Zfp974 UTSW 7 27910957 missense probably benign 0.01
R6419:Zfp974 UTSW 7 27911515 missense possibly damaging 0.72
R6654:Zfp974 UTSW 7 27926403 missense probably damaging 1.00
R6731:Zfp974 UTSW 7 27911649 missense possibly damaging 0.93
R7162:Zfp974 UTSW 7 27911519 missense possibly damaging 0.71
R7316:Zfp974 UTSW 7 27910438 missense possibly damaging 0.93
R7484:Zfp974 UTSW 7 27912134 missense possibly damaging 0.72
R7663:Zfp974 UTSW 7 27911685 missense possibly damaging 0.74
R7664:Zfp974 UTSW 7 27910712 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- TGAGACCATCCCCTCAAAGCTCTG -3'
(R):5'- AGACTCCTGTGTGCTTCCAATTTGTG -3'

Sequencing Primer
(F):5'- TGGGACTGACACCTCCAC -3'
(R):5'- CCAATTTGTGTGTGGGAGGC -3'
Posted On2013-05-09