Mutagenetix > Incidental Mutations

Incidental Mutation 'R0362:Ticrr'

36243

Institutional Source

Beutler Lab

Gene Symbol

Ticrr

Ensembl Gene

ENSMUSG00000046591

Gene Name

TOPBP1-interacting checkpoint and replication regulator

Synonyms

5730590G19Rik

MMRRC Submission

038568-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.951) question?

Stock #

R0362 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

79660196-79698148 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 79677340 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 599 (S599G)

Ref Sequence

ENSEMBL: ENSMUSP00000145735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035977
AA Change: S599G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: S599G

Domain	Start	End	E-Value	Type
low complexity region	23	31	N/A	INTRINSIC
Pfam:Treslin_N	211	1005	N/A	PFAM
low complexity region	1186	1197	N/A	INTRINSIC
low complexity region	1220	1235	N/A	INTRINSIC
low complexity region	1339	1359	N/A	INTRINSIC
low complexity region	1472	1480	N/A	INTRINSIC
low complexity region	1496	1514	N/A	INTRINSIC
low complexity region	1630	1643	N/A	INTRINSIC
low complexity region	1694	1707	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000206017

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206072

Predicted Effect

probably damaging
Transcript: ENSMUST00000206591
AA Change: S599G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206622
AA Change: S599G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206677

Meta Mutation Damage Score

0.0719

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 96.8%
20x: 94.0%

Validation Efficiency

99% (104/105)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	A	G	2: 68,732,917	Q401R	probably benign	Het
Acpp	A	G	9: 104,314,427	F220S	probably damaging	Het
Adam7	A	G	14: 68,509,656		probably benign	Het
Adamts6	A	G	13: 104,390,076		probably null	Het
Ascc3	T	C	10: 50,748,955		probably benign	Het
Atg10	T	C	13: 91,040,990		probably null	Het
Atm	T	C	9: 53,458,838	I2325V	possibly damaging	Het
Btnl9	C	T	11: 49,169,616	R435H	possibly damaging	Het
Ccdc180	A	G	4: 45,923,551	K1111E	probably damaging	Het
Col11a2	T	A	17: 34,062,446		probably null	Het
Ctcfl	A	G	2: 173,118,443	W116R	probably damaging	Het
Ctsk	A	T	3: 95,500,944	Y37F	probably damaging	Het
Daam2	G	C	17: 49,480,785		probably null	Het
Dcdc2b	T	C	4: 129,610,238		probably null	Het
Ddx28	C	T	8: 106,011,294	R44Q	probably damaging	Het
Dhx29	T	A	13: 112,962,859	N1139K	probably benign	Het
Dnah17	A	T	11: 118,098,539	M1281K	probably benign	Het
Dnah6	T	C	6: 73,208,609	S110G	probably benign	Het
Drc7	T	C	8: 95,072,855	Y553H	probably benign	Het
Dync2h1	T	C	9: 7,005,487		probably null	Het
Ecm1	A	G	3: 95,737,057	I152T	possibly damaging	Het
Edc4	C	G	8: 105,886,775	P307R	probably damaging	Het
Egr1	A	G	18: 34,863,313	T383A	possibly damaging	Het
Eml2	A	G	7: 19,190,806		probably null	Het
Eno4	A	G	19: 58,943,624		probably benign	Het
Erbb4	A	T	1: 68,330,270	I404K	probably damaging	Het
Exoc7	G	T	11: 116,295,662	T310K	probably benign	Het
Fam102b	C	T	3: 108,980,181	E256K	probably benign	Het
Fam83e	G	T	7: 45,726,969	V369L	probably benign	Het
Fam96b	T	C	8: 104,641,590	D34G	probably null	Het
Fancc	A	T	13: 63,398,156	I91K	possibly damaging	Het
Fbn1	T	C	2: 125,309,777	Q2519R	probably damaging	Het
Fhod3	T	A	18: 25,090,076	C826*	probably null	Het
Foxi3	A	G	6: 70,956,628	D33G	probably benign	Het
Gcn1l1	T	C	5: 115,576,108		probably benign	Het
Gm14221	T	C	2: 160,568,390		noncoding transcript	Het
Golga4	T	A	9: 118,555,785	H630Q	probably benign	Het
Gpat4	T	C	8: 23,180,933	S88G	probably benign	Het
Gucy2d	A	T	7: 98,443,685	S90C	probably damaging	Het
Has2	A	C	15: 56,681,661	C182G	probably damaging	Het
Heatr5a	A	T	12: 51,888,861	S1647R	probably damaging	Het
Ifi35	T	C	11: 101,457,212	V48A	probably benign	Het
Lig1	T	A	7: 13,296,804		probably benign	Het
Magi2	A	G	5: 19,227,575	K96R	probably damaging	Het
Map7d1	G	T	4: 126,234,994	P462Q	probably damaging	Het
Mdn1	A	T	4: 32,746,439		probably null	Het
Mfsd4a	A	T	1: 132,059,275	V105E	probably damaging	Het
Mrpl53	C	T	6: 83,109,545	R77C	probably damaging	Het
Mtnr1b	C	T	9: 15,874,304	V53M	probably damaging	Het
Myo9b	T	C	8: 71,347,770	W990R	probably damaging	Het
Myt1	A	T	2: 181,763,393		probably benign	Het
Nf1	C	T	11: 79,536,878	A1766V	probably damaging	Het
Nlrp3	T	C	11: 59,548,797	V400A	possibly damaging	Het
Nup205	T	A	6: 35,196,714		probably null	Het
Nxf1	T	C	19: 8,764,151		probably null	Het
Olfr1352	A	T	10: 78,984,386	M199L	probably benign	Het
P4hb	T	C	11: 120,563,336	K311E	probably benign	Het
Pafah1b1	T	C	11: 74,683,631	N243S	probably benign	Het
Parp8	G	A	13: 116,924,968	Q141*	probably null	Het
Pkd2l2	A	C	18: 34,435,327	D543A	probably benign	Het
Pld5	A	T	1: 175,975,580	L311*	probably null	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Plpp5	A	T	8: 25,724,192	T144S	probably benign	Het
Ppp6r3	A	G	19: 3,478,285	L542S	probably damaging	Het
Prkar2b	A	T	12: 31,987,974		probably null	Het
Psmg1	A	T	16: 95,987,971	S129T	possibly damaging	Het
Radil	T	C	5: 142,543,827	D38G	probably benign	Het
Ric1	T	C	19: 29,601,011		probably null	Het
Rp1l1	T	A	14: 64,031,066	L1367*	probably null	Het
Rxfp1	A	T	3: 79,737,793	M1K	probably null	Het
Serpina6	G	T	12: 103,651,949	L202I	probably damaging	Het
Simc1	T	C	13: 54,528,467	I98T	probably damaging	Het
Slc17a6	A	G	7: 51,658,771	Y281C	probably damaging	Het
Slc26a11	T	A	11: 119,379,941		probably benign	Het
Slc34a1	T	A	13: 55,402,898		probably null	Het
Slfn10-ps	T	A	11: 83,035,774		noncoding transcript	Het
Sohlh2	A	G	3: 55,207,742	N383D	probably damaging	Het
Spag6	T	A	2: 18,710,491	L27H	probably damaging	Het
Sptlc3	A	G	2: 139,546,555		probably benign	Het
St3gal4	T	A	9: 35,053,173	K199*	probably null	Het
Stat5a	T	A	11: 100,882,083	D712E	probably benign	Het
Stmn2	A	T	3: 8,545,690	D78V	probably damaging	Het
Stpg1	C	T	4: 135,506,466	P20S	possibly damaging	Het
Taf2	A	T	15: 55,045,929	V640E	probably damaging	Het
Tbce	T	C	13: 13,998,162	E501G	probably benign	Het
Tecpr2	A	G	12: 110,968,940	S1398G	probably damaging	Het
Tenm4	T	A	7: 96,772,035	Y598*	probably null	Het
Tnc	A	C	4: 64,017,442	V419G	probably damaging	Het
Trappc1	C	A	11: 69,325,576	P110T	probably benign	Het
Trbv12-2	C	T	6: 41,119,059		probably benign	Het
Ttbk2	A	T	2: 120,745,783	N835K	possibly damaging	Het
Tubgcp5	A	G	7: 55,800,684	D181G	probably damaging	Het
Tut1	T	C	19: 8,955,527	Y75H	possibly damaging	Het
Ulk2	C	A	11: 61,787,586	C769F	probably benign	Het
Vdac1	T	C	11: 52,374,973		probably benign	Het
Vmn2r124	T	C	17: 18,064,224		probably null	Het
Vps8	T	C	16: 21,608,227		probably benign	Het
Wdr35	T	C	12: 8,995,625		probably benign	Het
Zdhhc7	T	A	8: 120,086,647	E141V	probably null	Het
Zfp12	C	A	5: 143,245,223	S435Y	probably damaging	Het
Zfp974	A	T	7: 27,927,394		probably benign	Het
Zfyve9	T	A	4: 108,680,969	K1033N	probably damaging	Het
Zswim8	T	A	14: 20,721,945	S1572T	possibly damaging	Het

Other mutations in Ticrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Ticrr	APN	7	79677283	missense	probably damaging	1.00
IGL00596:Ticrr	APN	7	79677293	missense	probably damaging	1.00
IGL01327:Ticrr	APN	7	79694461	missense	probably benign	0.00
IGL01525:Ticrr	APN	7	79682449	missense	probably damaging	1.00
IGL01565:Ticrr	APN	7	79694548	missense	probably benign
IGL01936:Ticrr	APN	7	79694549	missense	probably benign	0.11
IGL02160:Ticrr	APN	7	79694019	missense	probably benign	0.29
IGL02246:Ticrr	APN	7	79675328	missense	probably damaging	1.00
IGL02487:Ticrr	APN	7	79683021	missense	possibly damaging	0.86
IGL02593:Ticrr	APN	7	79695466	missense	probably damaging	0.99
IGL02970:Ticrr	APN	7	79695171	missense	probably benign	0.01
FR4304:Ticrr	UTSW	7	79694311	intron	probably benign
PIT4305001:Ticrr	UTSW	7	79679023	missense	possibly damaging	0.95
PIT4791001:Ticrr	UTSW	7	79669638	missense	possibly damaging	0.92
R0016:Ticrr	UTSW	7	79693792	missense	probably benign	0.01
R0062:Ticrr	UTSW	7	79667906	missense	probably benign	0.01
R0062:Ticrr	UTSW	7	79667906	missense	probably benign	0.01
R0067:Ticrr	UTSW	7	79677410	missense	probably damaging	1.00
R0067:Ticrr	UTSW	7	79677410	missense	probably damaging	1.00
R0482:Ticrr	UTSW	7	79694488	missense	probably damaging	0.99
R0595:Ticrr	UTSW	7	79695563	missense	possibly damaging	0.94
R1118:Ticrr	UTSW	7	79693953	missense	probably benign	0.23
R1119:Ticrr	UTSW	7	79693953	missense	probably benign	0.23
R1572:Ticrr	UTSW	7	79681824	missense	probably damaging	1.00
R1658:Ticrr	UTSW	7	79695549	missense	possibly damaging	0.57
R1757:Ticrr	UTSW	7	79675323	missense	probably damaging	0.99
R1757:Ticrr	UTSW	7	79679046	nonsense	probably null
R1862:Ticrr	UTSW	7	79695207	missense	probably damaging	1.00
R1869:Ticrr	UTSW	7	79679135	missense	probably damaging	1.00
R1938:Ticrr	UTSW	7	79675394	missense	probably damaging	0.98
R1966:Ticrr	UTSW	7	79694735	nonsense	probably null
R2006:Ticrr	UTSW	7	79694073	missense	possibly damaging	0.93
R2178:Ticrr	UTSW	7	79665685	missense	probably benign	0.12
R3404:Ticrr	UTSW	7	79694791	missense	probably benign	0.06
R3405:Ticrr	UTSW	7	79694791	missense	probably benign	0.06
R3941:Ticrr	UTSW	7	79693697	intron	probably benign
R3950:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R3951:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R3952:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R4967:Ticrr	UTSW	7	79660410	missense	probably damaging	0.99
R4972:Ticrr	UTSW	7	79669668	missense	probably damaging	0.98
R5259:Ticrr	UTSW	7	79694723	missense	probably benign	0.01
R5272:Ticrr	UTSW	7	79669605	missense	probably benign	0.44
R5374:Ticrr	UTSW	7	79690942	nonsense	probably null
R5480:Ticrr	UTSW	7	79660809	missense	probably damaging	1.00
R5568:Ticrr	UTSW	7	79689967	critical splice donor site	probably null
R5568:Ticrr	UTSW	7	79695296	nonsense	probably null
R5588:Ticrr	UTSW	7	79679105	missense	probably damaging	1.00
R5698:Ticrr	UTSW	7	79679133	missense	probably benign
R5879:Ticrr	UTSW	7	79696690	missense	probably benign	0.12
R5980:Ticrr	UTSW	7	79660955	missense	probably damaging	0.99
R6128:Ticrr	UTSW	7	79693968	missense	probably damaging	1.00
R6277:Ticrr	UTSW	7	79694696	missense	probably benign	0.00
R6335:Ticrr	UTSW	7	79694283	splice site	probably null
R6866:Ticrr	UTSW	7	79693957	missense	possibly damaging	0.47
R6905:Ticrr	UTSW	7	79665850	missense	probably benign	0.00
R6923:Ticrr	UTSW	7	79691853	missense	probably damaging	0.98
R6962:Ticrr	UTSW	7	79665897	missense	possibly damaging	0.84
R7232:Ticrr	UTSW	7	79693742	missense	probably damaging	0.96
R7285:Ticrr	UTSW	7	79660862	missense	possibly damaging	0.93
R7385:Ticrr	UTSW	7	79691849	missense	possibly damaging	0.93
R7426:Ticrr	UTSW	7	79693986	missense	probably benign
R7583:Ticrr	UTSW	7	79696739	nonsense	probably null
R7749:Ticrr	UTSW	7	79679096	missense	possibly damaging	0.94
R7863:Ticrr	UTSW	7	79682012	missense	possibly damaging	0.92
R7899:Ticrr	UTSW	7	79669485	missense	probably benign	0.23
R7935:Ticrr	UTSW	7	79681836	missense	probably damaging	0.99
R8005:Ticrr	UTSW	7	79694048	missense	probably damaging	0.98
R8080:Ticrr	UTSW	7	79684264	splice site	probably null
R8181:Ticrr	UTSW	7	79660980	missense	possibly damaging	0.92
R8349:Ticrr	UTSW	7	79694680	missense	probably benign	0.27
R8410:Ticrr	UTSW	7	79667675	missense	probably damaging	0.98
R8449:Ticrr	UTSW	7	79694680	missense	probably benign	0.27

Predicted Primers

PCR Primer
(F):5'- AAGAAGAAGCGTCTCCTCGCCA -3'
(R):5'- gattcctcagcctcCAGACCTCTTA -3'

Sequencing Primer
(F):5'- ggcagcacacagccatc -3'
(R):5'- TATATAATAACAGACACCAGACGCTC -3'

Posted On

2013-05-09