Incidental Mutation 'R0362:Ddx28'
ID36252
Institutional Source Beutler Lab
Gene Symbol Ddx28
Ensembl Gene ENSMUSG00000045538
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 28
Synonyms2410004K13Rik, Mddx28
MMRRC Submission 038568-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R0362 (G1)
Quality Score184
Status Validated
Chromosome8
Chromosomal Location106009621-106011882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106011294 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 44 (R44Q)
Ref Sequence ENSEMBL: ENSMUSP00000058950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034375] [ENSMUST00000058579] [ENSMUST00000119736] [ENSMUST00000142898]
Predicted Effect probably benign
Transcript: ENSMUST00000034375
SMART Domains Protein: ENSMUSP00000034375
Gene: ENSMUSG00000031901

DomainStartEndE-ValueType
Pfam:Dus 15 344 1.8e-54 PFAM
DSRM 370 435 1.03e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000058579
AA Change: R44Q

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058950
Gene: ENSMUSG00000045538
AA Change: R44Q

DomainStartEndE-ValueType
low complexity region 8 18 N/A INTRINSIC
low complexity region 42 58 N/A INTRINSIC
DEXDc 147 365 1.64e-40 SMART
HELICc 411 492 6.89e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119736
SMART Domains Protein: ENSMUSP00000113781
Gene: ENSMUSG00000031901

DomainStartEndE-ValueType
Pfam:Dus 1 233 8.1e-38 PFAM
DSRM 257 322 1.03e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141374
Predicted Effect probably benign
Transcript: ENSMUST00000142898
Meta Mutation Damage Score 0.1553 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 99% (104/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene is intronless. It encodes an RNA-dependent ATPase. The encoded protein is localized in the mitochondria and the nucleus, and can be transported between the mitochondria and the nucleus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,732,917 Q401R probably benign Het
Acpp A G 9: 104,314,427 F220S probably damaging Het
Adam7 A G 14: 68,509,656 probably benign Het
Adamts6 A G 13: 104,390,076 probably null Het
Ascc3 T C 10: 50,748,955 probably benign Het
Atg10 T C 13: 91,040,990 probably null Het
Atm T C 9: 53,458,838 I2325V possibly damaging Het
Btnl9 C T 11: 49,169,616 R435H possibly damaging Het
Ccdc180 A G 4: 45,923,551 K1111E probably damaging Het
Col11a2 T A 17: 34,062,446 probably null Het
Ctcfl A G 2: 173,118,443 W116R probably damaging Het
Ctsk A T 3: 95,500,944 Y37F probably damaging Het
Daam2 G C 17: 49,480,785 probably null Het
Dcdc2b T C 4: 129,610,238 probably null Het
Dhx29 T A 13: 112,962,859 N1139K probably benign Het
Dnah17 A T 11: 118,098,539 M1281K probably benign Het
Dnah6 T C 6: 73,208,609 S110G probably benign Het
Drc7 T C 8: 95,072,855 Y553H probably benign Het
Dync2h1 T C 9: 7,005,487 probably null Het
Ecm1 A G 3: 95,737,057 I152T possibly damaging Het
Edc4 C G 8: 105,886,775 P307R probably damaging Het
Egr1 A G 18: 34,863,313 T383A possibly damaging Het
Eml2 A G 7: 19,190,806 probably null Het
Eno4 A G 19: 58,943,624 probably benign Het
Erbb4 A T 1: 68,330,270 I404K probably damaging Het
Exoc7 G T 11: 116,295,662 T310K probably benign Het
Fam102b C T 3: 108,980,181 E256K probably benign Het
Fam83e G T 7: 45,726,969 V369L probably benign Het
Fam96b T C 8: 104,641,590 D34G probably null Het
Fancc A T 13: 63,398,156 I91K possibly damaging Het
Fbn1 T C 2: 125,309,777 Q2519R probably damaging Het
Fhod3 T A 18: 25,090,076 C826* probably null Het
Foxi3 A G 6: 70,956,628 D33G probably benign Het
Gcn1l1 T C 5: 115,576,108 probably benign Het
Gm14221 T C 2: 160,568,390 noncoding transcript Het
Golga4 T A 9: 118,555,785 H630Q probably benign Het
Gpat4 T C 8: 23,180,933 S88G probably benign Het
Gucy2d A T 7: 98,443,685 S90C probably damaging Het
Has2 A C 15: 56,681,661 C182G probably damaging Het
Heatr5a A T 12: 51,888,861 S1647R probably damaging Het
Ifi35 T C 11: 101,457,212 V48A probably benign Het
Lig1 T A 7: 13,296,804 probably benign Het
Magi2 A G 5: 19,227,575 K96R probably damaging Het
Map7d1 G T 4: 126,234,994 P462Q probably damaging Het
Mdn1 A T 4: 32,746,439 probably null Het
Mfsd4a A T 1: 132,059,275 V105E probably damaging Het
Mrpl53 C T 6: 83,109,545 R77C probably damaging Het
Mtnr1b C T 9: 15,874,304 V53M probably damaging Het
Myo9b T C 8: 71,347,770 W990R probably damaging Het
Myt1 A T 2: 181,763,393 probably benign Het
Nf1 C T 11: 79,536,878 A1766V probably damaging Het
Nlrp3 T C 11: 59,548,797 V400A possibly damaging Het
Nup205 T A 6: 35,196,714 probably null Het
Nxf1 T C 19: 8,764,151 probably null Het
Olfr1352 A T 10: 78,984,386 M199L probably benign Het
P4hb T C 11: 120,563,336 K311E probably benign Het
Pafah1b1 T C 11: 74,683,631 N243S probably benign Het
Parp8 G A 13: 116,924,968 Q141* probably null Het
Pkd2l2 A C 18: 34,435,327 D543A probably benign Het
Pld5 A T 1: 175,975,580 L311* probably null Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plpp5 A T 8: 25,724,192 T144S probably benign Het
Ppp6r3 A G 19: 3,478,285 L542S probably damaging Het
Prkar2b A T 12: 31,987,974 probably null Het
Psmg1 A T 16: 95,987,971 S129T possibly damaging Het
Radil T C 5: 142,543,827 D38G probably benign Het
Ric1 T C 19: 29,601,011 probably null Het
Rp1l1 T A 14: 64,031,066 L1367* probably null Het
Rxfp1 A T 3: 79,737,793 M1K probably null Het
Serpina6 G T 12: 103,651,949 L202I probably damaging Het
Simc1 T C 13: 54,528,467 I98T probably damaging Het
Slc17a6 A G 7: 51,658,771 Y281C probably damaging Het
Slc26a11 T A 11: 119,379,941 probably benign Het
Slc34a1 T A 13: 55,402,898 probably null Het
Slfn10-ps T A 11: 83,035,774 noncoding transcript Het
Sohlh2 A G 3: 55,207,742 N383D probably damaging Het
Spag6 T A 2: 18,710,491 L27H probably damaging Het
Sptlc3 A G 2: 139,546,555 probably benign Het
St3gal4 T A 9: 35,053,173 K199* probably null Het
Stat5a T A 11: 100,882,083 D712E probably benign Het
Stmn2 A T 3: 8,545,690 D78V probably damaging Het
Stpg1 C T 4: 135,506,466 P20S possibly damaging Het
Taf2 A T 15: 55,045,929 V640E probably damaging Het
Tbce T C 13: 13,998,162 E501G probably benign Het
Tecpr2 A G 12: 110,968,940 S1398G probably damaging Het
Tenm4 T A 7: 96,772,035 Y598* probably null Het
Ticrr A G 7: 79,677,340 S599G probably damaging Het
Tnc A C 4: 64,017,442 V419G probably damaging Het
Trappc1 C A 11: 69,325,576 P110T probably benign Het
Trbv12-2 C T 6: 41,119,059 probably benign Het
Ttbk2 A T 2: 120,745,783 N835K possibly damaging Het
Tubgcp5 A G 7: 55,800,684 D181G probably damaging Het
Tut1 T C 19: 8,955,527 Y75H possibly damaging Het
Ulk2 C A 11: 61,787,586 C769F probably benign Het
Vdac1 T C 11: 52,374,973 probably benign Het
Vmn2r124 T C 17: 18,064,224 probably null Het
Vps8 T C 16: 21,608,227 probably benign Het
Wdr35 T C 12: 8,995,625 probably benign Het
Zdhhc7 T A 8: 120,086,647 E141V probably null Het
Zfp12 C A 5: 143,245,223 S435Y probably damaging Het
Zfp974 A T 7: 27,927,394 probably benign Het
Zfyve9 T A 4: 108,680,969 K1033N probably damaging Het
Zswim8 T A 14: 20,721,945 S1572T possibly damaging Het
Other mutations in Ddx28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Ddx28 APN 8 106010580 missense probably damaging 0.97
R0166:Ddx28 UTSW 8 106010289 missense probably benign 0.00
R0329:Ddx28 UTSW 8 106010245 missense probably benign 0.00
R0464:Ddx28 UTSW 8 106010053 missense probably damaging 1.00
R1267:Ddx28 UTSW 8 106009917 missense probably damaging 1.00
R1686:Ddx28 UTSW 8 106010558 missense probably damaging 1.00
R1748:Ddx28 UTSW 8 106010682 missense probably benign 0.01
R2201:Ddx28 UTSW 8 106010574 missense probably damaging 1.00
R4005:Ddx28 UTSW 8 106010928 missense possibly damaging 0.80
R6456:Ddx28 UTSW 8 106010368 missense possibly damaging 0.94
R6601:Ddx28 UTSW 8 106010616 unclassified probably null
R7295:Ddx28 UTSW 8 106010844 missense probably benign
R7320:Ddx28 UTSW 8 106011325 missense probably damaging 0.96
R7690:Ddx28 UTSW 8 106010331 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCGTCTTGCCACTGCCAGTTTC -3'
(R):5'- AGATGACTCCAATCTGGACATCGCC -3'

Sequencing Primer
(F):5'- AGGTTGGCTGCACAACTTC -3'
(R):5'- GGTGGAAACCTACAGACCTCG -3'
Posted On2013-05-09