Incidental Mutation 'R0362:St3gal4'
ID36256
Institutional Source Beutler Lab
Gene Symbol St3gal4
Ensembl Gene ENSMUSG00000032038
Gene NameST3 beta-galactoside alpha-2,3-sialyltransferase 4
SynonymsST3Gal IV, Siat4c
MMRRC Submission 038568-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R0362 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location35046576-35119268 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 35053173 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 199 (K199*)
Ref Sequence ENSEMBL: ENSMUSP00000150841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034537] [ENSMUST00000213526] [ENSMUST00000214526] [ENSMUST00000215089] [ENSMUST00000215463] [ENSMUST00000215638] [ENSMUST00000216557] [ENSMUST00000217149] [ENSMUST00000217542]
Predicted Effect probably null
Transcript: ENSMUST00000034537
AA Change: K178*
SMART Domains Protein: ENSMUSP00000034537
Gene: ENSMUSG00000032038
AA Change: K178*

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:Glyco_transf_29 70 332 4.1e-59 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213526
AA Change: K199*
Predicted Effect probably benign
Transcript: ENSMUST00000214526
Predicted Effect probably benign
Transcript: ENSMUST00000215089
Predicted Effect probably benign
Transcript: ENSMUST00000215463
Predicted Effect probably benign
Transcript: ENSMUST00000215638
Predicted Effect probably benign
Transcript: ENSMUST00000216557
Predicted Effect probably benign
Transcript: ENSMUST00000217149
Predicted Effect probably benign
Transcript: ENSMUST00000217542
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 99% (104/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycosyltransferase 29 family, a group of enzymes involved in protein glycosylation. The encoded protein is targeted to Golgi membranes but may be proteolytically processed and secreted. The gene product may also be involved in the increased expression of sialyl Lewis X antigen seen in inflammatory responses. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygotes for a null allele show thrombocytopenia, altered platelet physiology, increased bleeding times, and abnormal leukocyte migration. Homozygotes for a different null allele fail to develop seizures in response to kindling, and show anxiety-like behaviors and altered sleep patterns. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,732,917 Q401R probably benign Het
Acpp A G 9: 104,314,427 F220S probably damaging Het
Adam7 A G 14: 68,509,656 probably benign Het
Adamts6 A G 13: 104,390,076 probably null Het
Ascc3 T C 10: 50,748,955 probably benign Het
Atg10 T C 13: 91,040,990 probably null Het
Atm T C 9: 53,458,838 I2325V possibly damaging Het
Btnl9 C T 11: 49,169,616 R435H possibly damaging Het
Ccdc180 A G 4: 45,923,551 K1111E probably damaging Het
Col11a2 T A 17: 34,062,446 probably null Het
Ctcfl A G 2: 173,118,443 W116R probably damaging Het
Ctsk A T 3: 95,500,944 Y37F probably damaging Het
Daam2 G C 17: 49,480,785 probably null Het
Dcdc2b T C 4: 129,610,238 probably null Het
Ddx28 C T 8: 106,011,294 R44Q probably damaging Het
Dhx29 T A 13: 112,962,859 N1139K probably benign Het
Dnah17 A T 11: 118,098,539 M1281K probably benign Het
Dnah6 T C 6: 73,208,609 S110G probably benign Het
Drc7 T C 8: 95,072,855 Y553H probably benign Het
Dync2h1 T C 9: 7,005,487 probably null Het
Ecm1 A G 3: 95,737,057 I152T possibly damaging Het
Edc4 C G 8: 105,886,775 P307R probably damaging Het
Egr1 A G 18: 34,863,313 T383A possibly damaging Het
Eml2 A G 7: 19,190,806 probably null Het
Eno4 A G 19: 58,943,624 probably benign Het
Erbb4 A T 1: 68,330,270 I404K probably damaging Het
Exoc7 G T 11: 116,295,662 T310K probably benign Het
Fam102b C T 3: 108,980,181 E256K probably benign Het
Fam83e G T 7: 45,726,969 V369L probably benign Het
Fam96b T C 8: 104,641,590 D34G probably null Het
Fancc A T 13: 63,398,156 I91K possibly damaging Het
Fbn1 T C 2: 125,309,777 Q2519R probably damaging Het
Fhod3 T A 18: 25,090,076 C826* probably null Het
Foxi3 A G 6: 70,956,628 D33G probably benign Het
Gcn1l1 T C 5: 115,576,108 probably benign Het
Gm14221 T C 2: 160,568,390 noncoding transcript Het
Golga4 T A 9: 118,555,785 H630Q probably benign Het
Gpat4 T C 8: 23,180,933 S88G probably benign Het
Gucy2d A T 7: 98,443,685 S90C probably damaging Het
Has2 A C 15: 56,681,661 C182G probably damaging Het
Heatr5a A T 12: 51,888,861 S1647R probably damaging Het
Ifi35 T C 11: 101,457,212 V48A probably benign Het
Lig1 T A 7: 13,296,804 probably benign Het
Magi2 A G 5: 19,227,575 K96R probably damaging Het
Map7d1 G T 4: 126,234,994 P462Q probably damaging Het
Mdn1 A T 4: 32,746,439 probably null Het
Mfsd4a A T 1: 132,059,275 V105E probably damaging Het
Mrpl53 C T 6: 83,109,545 R77C probably damaging Het
Mtnr1b C T 9: 15,874,304 V53M probably damaging Het
Myo9b T C 8: 71,347,770 W990R probably damaging Het
Myt1 A T 2: 181,763,393 probably benign Het
Nf1 C T 11: 79,536,878 A1766V probably damaging Het
Nlrp3 T C 11: 59,548,797 V400A possibly damaging Het
Nup205 T A 6: 35,196,714 probably null Het
Nxf1 T C 19: 8,764,151 probably null Het
Olfr1352 A T 10: 78,984,386 M199L probably benign Het
P4hb T C 11: 120,563,336 K311E probably benign Het
Pafah1b1 T C 11: 74,683,631 N243S probably benign Het
Parp8 G A 13: 116,924,968 Q141* probably null Het
Pkd2l2 A C 18: 34,435,327 D543A probably benign Het
Pld5 A T 1: 175,975,580 L311* probably null Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plpp5 A T 8: 25,724,192 T144S probably benign Het
Ppp6r3 A G 19: 3,478,285 L542S probably damaging Het
Prkar2b A T 12: 31,987,974 probably null Het
Psmg1 A T 16: 95,987,971 S129T possibly damaging Het
Radil T C 5: 142,543,827 D38G probably benign Het
Ric1 T C 19: 29,601,011 probably null Het
Rp1l1 T A 14: 64,031,066 L1367* probably null Het
Rxfp1 A T 3: 79,737,793 M1K probably null Het
Serpina6 G T 12: 103,651,949 L202I probably damaging Het
Simc1 T C 13: 54,528,467 I98T probably damaging Het
Slc17a6 A G 7: 51,658,771 Y281C probably damaging Het
Slc26a11 T A 11: 119,379,941 probably benign Het
Slc34a1 T A 13: 55,402,898 probably null Het
Slfn10-ps T A 11: 83,035,774 noncoding transcript Het
Sohlh2 A G 3: 55,207,742 N383D probably damaging Het
Spag6 T A 2: 18,710,491 L27H probably damaging Het
Sptlc3 A G 2: 139,546,555 probably benign Het
Stat5a T A 11: 100,882,083 D712E probably benign Het
Stmn2 A T 3: 8,545,690 D78V probably damaging Het
Stpg1 C T 4: 135,506,466 P20S possibly damaging Het
Taf2 A T 15: 55,045,929 V640E probably damaging Het
Tbce T C 13: 13,998,162 E501G probably benign Het
Tecpr2 A G 12: 110,968,940 S1398G probably damaging Het
Tenm4 T A 7: 96,772,035 Y598* probably null Het
Ticrr A G 7: 79,677,340 S599G probably damaging Het
Tnc A C 4: 64,017,442 V419G probably damaging Het
Trappc1 C A 11: 69,325,576 P110T probably benign Het
Trbv12-2 C T 6: 41,119,059 probably benign Het
Ttbk2 A T 2: 120,745,783 N835K possibly damaging Het
Tubgcp5 A G 7: 55,800,684 D181G probably damaging Het
Tut1 T C 19: 8,955,527 Y75H possibly damaging Het
Ulk2 C A 11: 61,787,586 C769F probably benign Het
Vdac1 T C 11: 52,374,973 probably benign Het
Vmn2r124 T C 17: 18,064,224 probably null Het
Vps8 T C 16: 21,608,227 probably benign Het
Wdr35 T C 12: 8,995,625 probably benign Het
Zdhhc7 T A 8: 120,086,647 E141V probably null Het
Zfp12 C A 5: 143,245,223 S435Y probably damaging Het
Zfp974 A T 7: 27,927,394 probably benign Het
Zfyve9 T A 4: 108,680,969 K1033N probably damaging Het
Zswim8 T A 14: 20,721,945 S1572T possibly damaging Het
Other mutations in St3gal4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:St3gal4 APN 9 35053069 unclassified probably benign
IGL01448:St3gal4 APN 9 35052331 missense probably benign 0.00
IGL01770:St3gal4 APN 9 35052305 missense possibly damaging 0.73
IGL02862:St3gal4 APN 9 35052247 missense probably benign 0.32
fuji UTSW 9 35053173 nonsense probably null
Granny_smith UTSW 9 35053262 missense probably damaging 1.00
R0863:St3gal4 UTSW 9 35053448 missense probably damaging 1.00
R1457:St3gal4 UTSW 9 35054757 missense possibly damaging 0.66
R1530:St3gal4 UTSW 9 35052296 missense probably benign 0.00
R4991:St3gal4 UTSW 9 35053136 missense possibly damaging 0.93
R5452:St3gal4 UTSW 9 35053456 missense probably damaging 1.00
R6277:St3gal4 UTSW 9 35053262 missense probably damaging 1.00
R7564:St3gal4 UTSW 9 35052253 missense probably benign 0.09
R7725:St3gal4 UTSW 9 35053079 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GTCCCTTCACCAATCCTTTAGGAGC -3'
(R):5'- TCAACAAGTACGACGTGGTCATCAG -3'

Sequencing Primer
(F):5'- TCCTTTAGGAGCATCATAAGGCG -3'
(R):5'- CATCAGGTGTGTGGTCATCCC -3'
Posted On2013-05-09