Incidental Mutation 'R0362:Dhx29'
ID36287
Institutional Source Beutler Lab
Gene Symbol Dhx29
Ensembl Gene ENSMUSG00000042426
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 29
SynonymsE130202M19Rik
MMRRC Submission 038568-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0362 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location112927454-112969432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112962859 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1139 (N1139K)
Ref Sequence ENSEMBL: ENSMUSP00000035244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038574]
Predicted Effect probably benign
Transcript: ENSMUST00000038574
AA Change: N1139K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000035244
Gene: ENSMUSG00000042426
AA Change: N1139K

DomainStartEndE-ValueType
low complexity region 10 36 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 209 225 N/A INTRINSIC
low complexity region 240 255 N/A INTRINSIC
coiled coil region 279 308 N/A INTRINSIC
low complexity region 343 358 N/A INTRINSIC
Blast:DEXDc 411 450 2e-14 BLAST
DEXDc 569 763 1.09e-27 SMART
low complexity region 846 856 N/A INTRINSIC
HELICc 880 985 6.1e-17 SMART
HA2 1047 1138 8.9e-26 SMART
Pfam:OB_NTP_bind 1178 1298 3.8e-19 PFAM
Meta Mutation Damage Score 0.0606 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 99% (104/105)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein functions in translation initiation, and is specifically required for ribosomal scanning across stable mRNA secondary structures during initiation codon selection. This protein may also play a role in sensing virally derived cytosolic nucleic acids. Knockdown of this gene results in reduced protein translation and impaired proliferation of cancer cells. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,732,917 Q401R probably benign Het
Acpp A G 9: 104,314,427 F220S probably damaging Het
Adam7 A G 14: 68,509,656 probably benign Het
Adamts6 A G 13: 104,390,076 probably null Het
Ascc3 T C 10: 50,748,955 probably benign Het
Atg10 T C 13: 91,040,990 probably null Het
Atm T C 9: 53,458,838 I2325V possibly damaging Het
Btnl9 C T 11: 49,169,616 R435H possibly damaging Het
Ccdc180 A G 4: 45,923,551 K1111E probably damaging Het
Col11a2 T A 17: 34,062,446 probably null Het
Ctcfl A G 2: 173,118,443 W116R probably damaging Het
Ctsk A T 3: 95,500,944 Y37F probably damaging Het
Daam2 G C 17: 49,480,785 probably null Het
Dcdc2b T C 4: 129,610,238 probably null Het
Ddx28 C T 8: 106,011,294 R44Q probably damaging Het
Dnah17 A T 11: 118,098,539 M1281K probably benign Het
Dnah6 T C 6: 73,208,609 S110G probably benign Het
Drc7 T C 8: 95,072,855 Y553H probably benign Het
Dync2h1 T C 9: 7,005,487 probably null Het
Ecm1 A G 3: 95,737,057 I152T possibly damaging Het
Edc4 C G 8: 105,886,775 P307R probably damaging Het
Egr1 A G 18: 34,863,313 T383A possibly damaging Het
Eml2 A G 7: 19,190,806 probably null Het
Eno4 A G 19: 58,943,624 probably benign Het
Erbb4 A T 1: 68,330,270 I404K probably damaging Het
Exoc7 G T 11: 116,295,662 T310K probably benign Het
Fam102b C T 3: 108,980,181 E256K probably benign Het
Fam83e G T 7: 45,726,969 V369L probably benign Het
Fam96b T C 8: 104,641,590 D34G probably null Het
Fancc A T 13: 63,398,156 I91K possibly damaging Het
Fbn1 T C 2: 125,309,777 Q2519R probably damaging Het
Fhod3 T A 18: 25,090,076 C826* probably null Het
Foxi3 A G 6: 70,956,628 D33G probably benign Het
Gcn1l1 T C 5: 115,576,108 probably benign Het
Gm14221 T C 2: 160,568,390 noncoding transcript Het
Golga4 T A 9: 118,555,785 H630Q probably benign Het
Gpat4 T C 8: 23,180,933 S88G probably benign Het
Gucy2d A T 7: 98,443,685 S90C probably damaging Het
Has2 A C 15: 56,681,661 C182G probably damaging Het
Heatr5a A T 12: 51,888,861 S1647R probably damaging Het
Ifi35 T C 11: 101,457,212 V48A probably benign Het
Lig1 T A 7: 13,296,804 probably benign Het
Magi2 A G 5: 19,227,575 K96R probably damaging Het
Map7d1 G T 4: 126,234,994 P462Q probably damaging Het
Mdn1 A T 4: 32,746,439 probably null Het
Mfsd4a A T 1: 132,059,275 V105E probably damaging Het
Mrpl53 C T 6: 83,109,545 R77C probably damaging Het
Mtnr1b C T 9: 15,874,304 V53M probably damaging Het
Myo9b T C 8: 71,347,770 W990R probably damaging Het
Myt1 A T 2: 181,763,393 probably benign Het
Nf1 C T 11: 79,536,878 A1766V probably damaging Het
Nlrp3 T C 11: 59,548,797 V400A possibly damaging Het
Nup205 T A 6: 35,196,714 probably null Het
Nxf1 T C 19: 8,764,151 probably null Het
Olfr1352 A T 10: 78,984,386 M199L probably benign Het
P4hb T C 11: 120,563,336 K311E probably benign Het
Pafah1b1 T C 11: 74,683,631 N243S probably benign Het
Parp8 G A 13: 116,924,968 Q141* probably null Het
Pkd2l2 A C 18: 34,435,327 D543A probably benign Het
Pld5 A T 1: 175,975,580 L311* probably null Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plpp5 A T 8: 25,724,192 T144S probably benign Het
Ppp6r3 A G 19: 3,478,285 L542S probably damaging Het
Prkar2b A T 12: 31,987,974 probably null Het
Psmg1 A T 16: 95,987,971 S129T possibly damaging Het
Radil T C 5: 142,543,827 D38G probably benign Het
Ric1 T C 19: 29,601,011 probably null Het
Rp1l1 T A 14: 64,031,066 L1367* probably null Het
Rxfp1 A T 3: 79,737,793 M1K probably null Het
Serpina6 G T 12: 103,651,949 L202I probably damaging Het
Simc1 T C 13: 54,528,467 I98T probably damaging Het
Slc17a6 A G 7: 51,658,771 Y281C probably damaging Het
Slc26a11 T A 11: 119,379,941 probably benign Het
Slc34a1 T A 13: 55,402,898 probably null Het
Slfn10-ps T A 11: 83,035,774 noncoding transcript Het
Sohlh2 A G 3: 55,207,742 N383D probably damaging Het
Spag6 T A 2: 18,710,491 L27H probably damaging Het
Sptlc3 A G 2: 139,546,555 probably benign Het
St3gal4 T A 9: 35,053,173 K199* probably null Het
Stat5a T A 11: 100,882,083 D712E probably benign Het
Stmn2 A T 3: 8,545,690 D78V probably damaging Het
Stpg1 C T 4: 135,506,466 P20S possibly damaging Het
Taf2 A T 15: 55,045,929 V640E probably damaging Het
Tbce T C 13: 13,998,162 E501G probably benign Het
Tecpr2 A G 12: 110,968,940 S1398G probably damaging Het
Tenm4 T A 7: 96,772,035 Y598* probably null Het
Ticrr A G 7: 79,677,340 S599G probably damaging Het
Tnc A C 4: 64,017,442 V419G probably damaging Het
Trappc1 C A 11: 69,325,576 P110T probably benign Het
Trbv12-2 C T 6: 41,119,059 probably benign Het
Ttbk2 A T 2: 120,745,783 N835K possibly damaging Het
Tubgcp5 A G 7: 55,800,684 D181G probably damaging Het
Tut1 T C 19: 8,955,527 Y75H possibly damaging Het
Ulk2 C A 11: 61,787,586 C769F probably benign Het
Vdac1 T C 11: 52,374,973 probably benign Het
Vmn2r124 T C 17: 18,064,224 probably null Het
Vps8 T C 16: 21,608,227 probably benign Het
Wdr35 T C 12: 8,995,625 probably benign Het
Zdhhc7 T A 8: 120,086,647 E141V probably null Het
Zfp12 C A 5: 143,245,223 S435Y probably damaging Het
Zfp974 A T 7: 27,927,394 probably benign Het
Zfyve9 T A 4: 108,680,969 K1033N probably damaging Het
Zswim8 T A 14: 20,721,945 S1572T possibly damaging Het
Other mutations in Dhx29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Dhx29 APN 13 112964603 missense probably benign 0.15
IGL00434:Dhx29 APN 13 112955225 missense probably benign 0.00
IGL00659:Dhx29 APN 13 112966635 splice site probably benign
IGL01618:Dhx29 APN 13 112965222 missense probably damaging 1.00
IGL01777:Dhx29 APN 13 112930872 missense probably benign 0.42
IGL02010:Dhx29 APN 13 112966634 critical splice donor site probably null
IGL02125:Dhx29 APN 13 112955300 splice site probably benign
IGL02324:Dhx29 APN 13 112927808 missense probably damaging 1.00
IGL02801:Dhx29 APN 13 112964646 missense probably damaging 1.00
R0001:Dhx29 UTSW 13 112964556 missense probably damaging 0.99
R0468:Dhx29 UTSW 13 112963277 missense probably benign
R0569:Dhx29 UTSW 13 112948214 missense probably benign 0.01
R0714:Dhx29 UTSW 13 112927965 missense possibly damaging 0.55
R1460:Dhx29 UTSW 13 112965210 splice site probably benign
R1579:Dhx29 UTSW 13 112935598 critical splice donor site probably null
R1657:Dhx29 UTSW 13 112952843 missense probably damaging 1.00
R1735:Dhx29 UTSW 13 112945086 missense probably benign 0.00
R1768:Dhx29 UTSW 13 112948240 missense probably damaging 1.00
R1851:Dhx29 UTSW 13 112948281 missense probably damaging 1.00
R1937:Dhx29 UTSW 13 112965330 missense probably benign 0.06
R2180:Dhx29 UTSW 13 112962872 critical splice donor site probably null
R2219:Dhx29 UTSW 13 112952804 missense probably damaging 1.00
R2442:Dhx29 UTSW 13 112946974 missense possibly damaging 0.94
R2679:Dhx29 UTSW 13 112947376 critical splice donor site probably null
R2908:Dhx29 UTSW 13 112927851 missense possibly damaging 0.78
R2912:Dhx29 UTSW 13 112935575 missense probably damaging 1.00
R3414:Dhx29 UTSW 13 112947273 missense probably damaging 0.99
R3931:Dhx29 UTSW 13 112958965 missense probably damaging 1.00
R3957:Dhx29 UTSW 13 112930921 missense probably benign
R4065:Dhx29 UTSW 13 112964742 critical splice donor site probably null
R4207:Dhx29 UTSW 13 112927949 missense probably benign 0.01
R4422:Dhx29 UTSW 13 112947247 missense probably damaging 1.00
R4717:Dhx29 UTSW 13 112946935 missense unknown
R4718:Dhx29 UTSW 13 112946935 missense unknown
R5125:Dhx29 UTSW 13 112932600 missense possibly damaging 0.81
R5178:Dhx29 UTSW 13 112932600 missense possibly damaging 0.81
R5263:Dhx29 UTSW 13 112948221 missense probably damaging 1.00
R5458:Dhx29 UTSW 13 112966621 missense probably benign 0.00
R5469:Dhx29 UTSW 13 112944539 missense possibly damaging 0.94
R5541:Dhx29 UTSW 13 112940374 missense possibly damaging 0.47
R5573:Dhx29 UTSW 13 112933215 missense probably benign 0.07
R5664:Dhx29 UTSW 13 112946879 missense probably damaging 1.00
R5682:Dhx29 UTSW 13 112930849 missense probably damaging 1.00
R5769:Dhx29 UTSW 13 112953717 missense probably damaging 0.99
R5917:Dhx29 UTSW 13 112962843 missense probably damaging 1.00
R5928:Dhx29 UTSW 13 112964468 missense probably benign 0.00
R6115:Dhx29 UTSW 13 112952801 critical splice acceptor site probably null
R6144:Dhx29 UTSW 13 112964571 missense probably damaging 1.00
R6195:Dhx29 UTSW 13 112964537 missense probably benign 0.08
R6233:Dhx29 UTSW 13 112964537 missense probably benign 0.08
R6430:Dhx29 UTSW 13 112944619 missense possibly damaging 0.77
R6480:Dhx29 UTSW 13 112953788 nonsense probably null
R6527:Dhx29 UTSW 13 112932542 missense probably damaging 1.00
R6856:Dhx29 UTSW 13 112952861 missense probably benign 0.43
R7391:Dhx29 UTSW 13 112962859 missense probably benign
R7555:Dhx29 UTSW 13 112927642 start gained probably benign
R7602:Dhx29 UTSW 13 112944559 missense possibly damaging 0.95
R7974:Dhx29 UTSW 13 112940752 intron probably null
Predicted Primers PCR Primer
(F):5'- GCCAATGAGAATTAGCTGTCTGGAAGTC -3'
(R):5'- CTCTCAGAGGGAGGAACCCAAGG -3'

Sequencing Primer
(F):5'- GCTGTCTGGAAGTCTAAAGTACTAAG -3'
(R):5'- GGCCTTGCTCACTGTAGC -3'
Posted On2013-05-09