Incidental Mutation 'R0365:Ino80'
ID36319
Institutional Source Beutler Lab
Gene Symbol Ino80
Ensembl Gene ENSMUSG00000034154
Gene NameINO80 complex subunit
SynonymsINO80, 2310079N15Rik, 4632409L19Rik, Inoc1
MMRRC Submission 038571-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R0365 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location119373042-119477687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 119382960 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 1249 (R1249C)
Ref Sequence ENSEMBL: ENSMUSP00000051845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049920]
Predicted Effect probably damaging
Transcript: ENSMUST00000049920
AA Change: R1249C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: R1249C

DomainStartEndE-ValueType
coiled coil region 131 165 N/A INTRINSIC
low complexity region 206 242 N/A INTRINSIC
Pfam:DBINO 275 407 6.6e-50 PFAM
low complexity region 474 489 N/A INTRINSIC
DEXDc 516 714 6.27e-37 SMART
low complexity region 907 923 N/A INTRINSIC
HELICc 1134 1217 2.86e-22 SMART
low complexity region 1270 1324 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1424 1436 N/A INTRINSIC
low complexity region 1438 1450 N/A INTRINSIC
low complexity region 1457 1483 N/A INTRINSIC
low complexity region 1510 1521 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,692 M173K probably benign Het
Abcb1b T A 5: 8,806,009 F39Y probably damaging Het
Acbd3 A G 1: 180,738,612 Y290C probably damaging Het
Alg12 A C 15: 88,816,149 I28R possibly damaging Het
Amer2 A T 14: 60,379,535 D393V probably damaging Het
Anxa5 A T 3: 36,457,469 V153D probably damaging Het
Arl5a T C 2: 52,416,129 M64V probably benign Het
Armc4 T A 18: 7,217,800 H638L probably benign Het
Astn1 T C 1: 158,688,548 L1236P probably damaging Het
Atg2a T C 19: 6,247,683 S424P possibly damaging Het
AW551984 A T 9: 39,599,321 S239R probably benign Het
Baz1b T C 5: 135,240,131 V1278A probably benign Het
Cbfa2t3 G T 8: 122,635,060 L408I probably benign Het
Cdc27 A T 11: 104,528,424 N227K possibly damaging Het
Cdh23 T A 10: 60,379,315 N1412I probably damaging Het
Cdh7 A T 1: 110,108,756 Q555H probably damaging Het
Cdhr2 T C 13: 54,718,292 S302P probably benign Het
Cep350 C A 1: 155,906,571 E1563D probably benign Het
Cfap221 T A 1: 119,985,023 E107V probably benign Het
Col6a3 C A 1: 90,788,216 R1641L unknown Het
Coro6 A T 11: 77,464,090 I60F probably benign Het
Dock10 G T 1: 80,595,683 N245K probably damaging Het
Epb41l2 T A 10: 25,469,221 N286K probably damaging Het
Fam83g G T 11: 61,703,109 E490* probably null Het
Gm13088 G T 4: 143,655,501 Y208* probably null Het
Gnb1l T C 16: 18,552,461 I234T possibly damaging Het
Gtf3a T A 5: 146,948,937 W53R probably damaging Het
Ikzf4 T C 10: 128,634,407 I415V probably benign Het
Il11ra1 T C 4: 41,767,527 V293A probably damaging Het
Il17ra G A 6: 120,478,449 V340M probably benign Het
Kif24 A T 4: 41,428,731 H76Q probably benign Het
Klhl25 T C 7: 75,866,516 L390P probably damaging Het
Klhl26 T C 8: 70,451,829 D443G probably damaging Het
Lama3 A T 18: 12,507,007 R86S probably damaging Het
Lrrc24 G A 15: 76,715,784 A385V probably benign Het
Maea C T 5: 33,360,443 A109V probably benign Het
Mtor A T 4: 148,486,050 Y1188F probably benign Het
Nccrp1 T C 7: 28,544,552 D202G probably damaging Het
Nsun4 A T 4: 116,044,738 L177Q probably damaging Het
Nup155 C T 15: 8,131,543 R571W probably damaging Het
Nup160 T A 2: 90,708,844 M789K probably benign Het
Olfr262 A G 19: 12,241,076 F195S probably benign Het
Olfr469 A T 7: 107,822,917 L184* probably null Het
Olfr926 A T 9: 38,877,185 H3L probably benign Het
Pgpep1 G T 8: 70,652,524 probably null Het
Pkd1l2 C T 8: 117,021,850 V1861M probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plin4 G T 17: 56,104,667 T788K possibly damaging Het
Ppp3r2 T C 4: 49,681,902 D16G possibly damaging Het
Prdm16 A T 4: 154,342,056 I424N probably damaging Het
Psen2 T A 1: 180,228,845 I396F probably damaging Het
Psip1 C T 4: 83,485,712 probably null Het
Ptprd G A 4: 76,136,846 T215I probably damaging Het
Rec114 A G 9: 58,741,539 S2P probably benign Het
Rexo1 A G 10: 80,542,576 I1181T probably damaging Het
Rfx7 T C 9: 72,619,836 M1436T probably benign Het
Rnf213 T A 11: 119,426,111 V1020E possibly damaging Het
Rorc G A 3: 94,388,762 G83S probably damaging Het
Ryr2 T G 13: 11,668,839 Q3113P possibly damaging Het
Shank1 T C 7: 44,353,977 S1698P possibly damaging Het
Slc2a2 T C 3: 28,708,679 probably null Het
Slc5a9 A T 4: 111,891,836 Y98* probably null Het
Smc6 T C 12: 11,283,174 probably null Het
Sptb G T 12: 76,600,383 F1959L probably benign Het
Srgap1 T A 10: 121,785,705 H984L possibly damaging Het
Ssc5d T A 7: 4,928,467 C224* probably null Het
St5 A T 7: 109,538,949 V753E probably damaging Het
Ston2 A T 12: 91,647,860 H591Q probably benign Het
Tbx3 C T 5: 119,675,250 A222V possibly damaging Het
Thsd7a A G 6: 12,321,887 probably null Het
Usp9y T C Y: 1,364,732 D1027G probably damaging Het
Wnt5a C T 14: 28,518,504 R184* probably null Het
Zfpm2 A G 15: 40,774,066 E74G possibly damaging Het
Zwint C A 10: 72,657,295 S223* probably null Het
Other mutations in Ino80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01404:Ino80 APN 2 119456718 missense possibly damaging 0.83
IGL01985:Ino80 APN 2 119433321 missense probably damaging 0.99
IGL02039:Ino80 APN 2 119380073 missense probably damaging 1.00
IGL02187:Ino80 APN 2 119445457 splice site probably benign
IGL02726:Ino80 APN 2 119442483 missense probably damaging 1.00
PIT4677001:Ino80 UTSW 2 119377545 missense probably benign
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0004:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0057:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0113:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0114:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0115:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0138:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0189:Ino80 UTSW 2 119379679 missense probably benign 0.36
R0363:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0364:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0481:Ino80 UTSW 2 119431016 missense probably damaging 1.00
R0532:Ino80 UTSW 2 119381983 missense possibly damaging 0.79
R0580:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R0610:Ino80 UTSW 2 119382960 missense probably damaging 1.00
R0675:Ino80 UTSW 2 119383481 missense probably damaging 1.00
R1275:Ino80 UTSW 2 119427055 missense probably benign 0.12
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1470:Ino80 UTSW 2 119379649 missense probably damaging 1.00
R1506:Ino80 UTSW 2 119425265 nonsense probably null
R1510:Ino80 UTSW 2 119450049 missense probably damaging 1.00
R1570:Ino80 UTSW 2 119447028 missense possibly damaging 0.68
R1613:Ino80 UTSW 2 119392867 missense probably damaging 1.00
R1673:Ino80 UTSW 2 119381936 missense probably damaging 1.00
R1773:Ino80 UTSW 2 119418409 missense probably benign 0.18
R1795:Ino80 UTSW 2 119406859 missense probably damaging 1.00
R2093:Ino80 UTSW 2 119426670 missense possibly damaging 0.55
R2105:Ino80 UTSW 2 119431929 missense probably null 1.00
R2113:Ino80 UTSW 2 119454084 missense probably damaging 1.00
R3618:Ino80 UTSW 2 119446872 missense probably null 0.81
R4572:Ino80 UTSW 2 119402358 missense probably damaging 1.00
R4649:Ino80 UTSW 2 119431008 missense probably damaging 1.00
R4919:Ino80 UTSW 2 119442592 missense probably damaging 1.00
R5113:Ino80 UTSW 2 119431945 missense probably damaging 1.00
R5138:Ino80 UTSW 2 119383421 missense probably damaging 1.00
R5458:Ino80 UTSW 2 119412429 missense possibly damaging 0.50
R5499:Ino80 UTSW 2 119441647 missense probably damaging 1.00
R5502:Ino80 UTSW 2 119402396 missense probably damaging 1.00
R5531:Ino80 UTSW 2 119445575 missense probably benign
R5740:Ino80 UTSW 2 119431029 missense probably damaging 1.00
R5892:Ino80 UTSW 2 119439547 intron probably benign
R5914:Ino80 UTSW 2 119458216 missense probably damaging 0.99
R6000:Ino80 UTSW 2 119374508 missense probably benign 0.04
R6263:Ino80 UTSW 2 119383414 missense probably damaging 1.00
R6505:Ino80 UTSW 2 119451441 missense probably damaging 1.00
R6942:Ino80 UTSW 2 119383502 missense probably damaging 0.99
R7052:Ino80 UTSW 2 119426587 critical splice donor site probably null
R7100:Ino80 UTSW 2 119374513 missense possibly damaging 0.47
R7163:Ino80 UTSW 2 119392875 missense probably damaging 1.00
R7187:Ino80 UTSW 2 119426591 missense probably benign 0.00
R7202:Ino80 UTSW 2 119374437 missense probably benign 0.00
R7218:Ino80 UTSW 2 119458127 missense probably benign
R7389:Ino80 UTSW 2 119442529 missense probably benign 0.00
R7419:Ino80 UTSW 2 119380014 missense probably benign 0.00
R7437:Ino80 UTSW 2 119442586 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACTCACAGGAACTCAGGGTAAATCTGAA -3'
(R):5'- ACACTGATACCAGGAAGGGTGACAT -3'

Sequencing Primer
(F):5'- cacacacacacacacactc -3'
(R):5'- GACATTTCAGAGTTCACCTTGG -3'
Posted On2013-05-09