Incidental Mutation 'R0365:Gtf3a'
ID36338
Institutional Source Beutler Lab
Gene Symbol Gtf3a
Ensembl Gene ENSMUSG00000016503
Gene Namegeneral transcription factor III A
Synonyms
MMRRC Submission 038571-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R0365 (G1)
Quality Score90
Status Not validated
Chromosome5
Chromosomal Location146948657-146955614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 146948937 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 53 (W53R)
Ref Sequence ENSEMBL: ENSMUSP00000115824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066675] [ENSMUST00000132102] [ENSMUST00000146511]
Predicted Effect probably benign
Transcript: ENSMUST00000066675
SMART Domains Protein: ENSMUSP00000063398
Gene: ENSMUSG00000016510

DomainStartEndE-ValueType
Pfam:IF3_N 73 144 2.1e-13 PFAM
Pfam:IF3_C 153 238 2e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132102
AA Change: W53R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115824
Gene: ENSMUSG00000016503
AA Change: W53R

DomainStartEndE-ValueType
ZnF_C2H2 38 62 1.86e0 SMART
ZnF_C2H2 68 92 6.32e-3 SMART
ZnF_C2H2 98 123 1.38e-3 SMART
ZnF_C2H2 130 154 1.33e-1 SMART
ZnF_C2H2 160 184 1.45e-2 SMART
ZnF_C2H2 187 211 8.09e-1 SMART
ZnF_C2H2 215 237 5.99e-4 SMART
ZnF_C2H2 244 269 3.63e-3 SMART
ZnF_C2H2 275 299 2.09e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133296
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133682
Predicted Effect possibly damaging
Transcript: ENSMUST00000146511
AA Change: W53R

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119607
Gene: ENSMUSG00000016503
AA Change: W53R

DomainStartEndE-ValueType
ZnF_C2H2 38 62 1.86e0 SMART
ZnF_C2H2 68 92 6.32e-3 SMART
ZnF_C2H2 98 123 1.38e-3 SMART
ZnF_C2H2 130 154 1.33e-1 SMART
ZnF_C2H2 160 184 1.45e-2 SMART
ZnF_C2H2 187 211 8.09e-1 SMART
ZnF_C2H2 215 237 5.99e-4 SMART
ZnF_C2H2 244 269 3.63e-3 SMART
ZnF_C2H2 275 299 2.09e-3 SMART
low complexity region 338 361 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.6%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: The product of this gene is a zinc finger protein with nine Cis[2]-His[2] zinc finger domains. It functions as an RNA polymerase III transcription factor to induce transcription of the 5S rRNA genes. The protein binds to a 50 bp internal promoter in the 5S genes called the internal control region (ICR), and nucleates formation of a stable preinitiation complex. This complex recruits the TFIIIC and TFIIIB transcription factors and RNA polymerase III to form the complete transcription complex. The protein is thought to be translated using a non-AUG translation initiation site in mammals based on sequence analysis, protein homology, and the size of the purified protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,692 M173K probably benign Het
Abcb1b T A 5: 8,806,009 F39Y probably damaging Het
Acbd3 A G 1: 180,738,612 Y290C probably damaging Het
Alg12 A C 15: 88,816,149 I28R possibly damaging Het
Amer2 A T 14: 60,379,535 D393V probably damaging Het
Anxa5 A T 3: 36,457,469 V153D probably damaging Het
Arl5a T C 2: 52,416,129 M64V probably benign Het
Armc4 T A 18: 7,217,800 H638L probably benign Het
Astn1 T C 1: 158,688,548 L1236P probably damaging Het
Atg2a T C 19: 6,247,683 S424P possibly damaging Het
AW551984 A T 9: 39,599,321 S239R probably benign Het
Baz1b T C 5: 135,240,131 V1278A probably benign Het
Cbfa2t3 G T 8: 122,635,060 L408I probably benign Het
Cdc27 A T 11: 104,528,424 N227K possibly damaging Het
Cdh23 T A 10: 60,379,315 N1412I probably damaging Het
Cdh7 A T 1: 110,108,756 Q555H probably damaging Het
Cdhr2 T C 13: 54,718,292 S302P probably benign Het
Cep350 C A 1: 155,906,571 E1563D probably benign Het
Cfap221 T A 1: 119,985,023 E107V probably benign Het
Col6a3 C A 1: 90,788,216 R1641L unknown Het
Coro6 A T 11: 77,464,090 I60F probably benign Het
Dock10 G T 1: 80,595,683 N245K probably damaging Het
Epb41l2 T A 10: 25,469,221 N286K probably damaging Het
Fam83g G T 11: 61,703,109 E490* probably null Het
Gm13088 G T 4: 143,655,501 Y208* probably null Het
Gnb1l T C 16: 18,552,461 I234T possibly damaging Het
Ikzf4 T C 10: 128,634,407 I415V probably benign Het
Il11ra1 T C 4: 41,767,527 V293A probably damaging Het
Il17ra G A 6: 120,478,449 V340M probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Kif24 A T 4: 41,428,731 H76Q probably benign Het
Klhl25 T C 7: 75,866,516 L390P probably damaging Het
Klhl26 T C 8: 70,451,829 D443G probably damaging Het
Lama3 A T 18: 12,507,007 R86S probably damaging Het
Lrrc24 G A 15: 76,715,784 A385V probably benign Het
Maea C T 5: 33,360,443 A109V probably benign Het
Mtor A T 4: 148,486,050 Y1188F probably benign Het
Nccrp1 T C 7: 28,544,552 D202G probably damaging Het
Nsun4 A T 4: 116,044,738 L177Q probably damaging Het
Nup155 C T 15: 8,131,543 R571W probably damaging Het
Nup160 T A 2: 90,708,844 M789K probably benign Het
Olfr262 A G 19: 12,241,076 F195S probably benign Het
Olfr469 A T 7: 107,822,917 L184* probably null Het
Olfr926 A T 9: 38,877,185 H3L probably benign Het
Pgpep1 G T 8: 70,652,524 probably null Het
Pkd1l2 C T 8: 117,021,850 V1861M probably benign Het
Plekha5 G A 6: 140,591,747 R646K possibly damaging Het
Plin4 G T 17: 56,104,667 T788K possibly damaging Het
Ppp3r2 T C 4: 49,681,902 D16G possibly damaging Het
Prdm16 A T 4: 154,342,056 I424N probably damaging Het
Psen2 T A 1: 180,228,845 I396F probably damaging Het
Psip1 C T 4: 83,485,712 probably null Het
Ptprd G A 4: 76,136,846 T215I probably damaging Het
Rec114 A G 9: 58,741,539 S2P probably benign Het
Rexo1 A G 10: 80,542,576 I1181T probably damaging Het
Rfx7 T C 9: 72,619,836 M1436T probably benign Het
Rnf213 T A 11: 119,426,111 V1020E possibly damaging Het
Rorc G A 3: 94,388,762 G83S probably damaging Het
Ryr2 T G 13: 11,668,839 Q3113P possibly damaging Het
Shank1 T C 7: 44,353,977 S1698P possibly damaging Het
Slc2a2 T C 3: 28,708,679 probably null Het
Slc5a9 A T 4: 111,891,836 Y98* probably null Het
Smc6 T C 12: 11,283,174 probably null Het
Sptb G T 12: 76,600,383 F1959L probably benign Het
Srgap1 T A 10: 121,785,705 H984L possibly damaging Het
Ssc5d T A 7: 4,928,467 C224* probably null Het
St5 A T 7: 109,538,949 V753E probably damaging Het
Ston2 A T 12: 91,647,860 H591Q probably benign Het
Tbx3 C T 5: 119,675,250 A222V possibly damaging Het
Thsd7a A G 6: 12,321,887 probably null Het
Usp9y T C Y: 1,364,732 D1027G probably damaging Het
Wnt5a C T 14: 28,518,504 R184* probably null Het
Zfpm2 A G 15: 40,774,066 E74G possibly damaging Het
Zwint C A 10: 72,657,295 S223* probably null Het
Other mutations in Gtf3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03096:Gtf3a APN 5 146953953 missense probably damaging 1.00
IGL03404:Gtf3a APN 5 146950639 splice site probably null
R0227:Gtf3a UTSW 5 146955389 missense probably damaging 1.00
R0480:Gtf3a UTSW 5 146953229 missense probably damaging 1.00
R1697:Gtf3a UTSW 5 146951913 missense possibly damaging 0.88
R2171:Gtf3a UTSW 5 146955462 missense probably benign 0.00
R3917:Gtf3a UTSW 5 146955434 missense probably benign 0.26
R4867:Gtf3a UTSW 5 146951913 nonsense probably null
R5081:Gtf3a UTSW 5 146951282 missense probably benign 0.36
R5268:Gtf3a UTSW 5 146955155 missense probably damaging 1.00
R6056:Gtf3a UTSW 5 146955528 unclassified probably benign
R6376:Gtf3a UTSW 5 146953988 unclassified probably null
R7151:Gtf3a UTSW 5 146951275 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGTTCCCGGAAGTTCAAAGTCTCC -3'
(R):5'- TGACCACCTTTACCCACAGCCTTAG -3'

Sequencing Primer
(F):5'- AAGTTCAAAGTCTCCGGGCG -3'
(R):5'- GGAAATCCTGACATCCTAGAATTCG -3'
Posted On2013-05-09