Mutagenetix > Incidental Mutations

Incidental Mutation 'R0365:St5'

36347

Institutional Source

Beutler Lab

Gene Symbol

St5

Ensembl Gene

ENSMUSG00000031024

Gene Name

suppression of tumorigenicity 5

Synonyms

2610305K15Rik, 2010004M01Rik

MMRRC Submission

038571-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.520) question?

Stock #

R0365 (G1)

Quality Score

222

Status

Not validated

Chromosome

Chromosomal Location

109523911-109703605 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 109538949 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 753 (V753E)

Ref Sequence

ENSEMBL: ENSMUSP00000078264 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077909] [ENSMUST00000079282] [ENSMUST00000084738] [ENSMUST00000168005]

Predicted Effect

probably damaging
Transcript: ENSMUST00000077909
AA Change: V753E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077067
Gene: ENSMUSG00000031024
AA Change: V753E

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000079282
AA Change: V753E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000078264
Gene: ENSMUSG00000031024
AA Change: V753E

Domain	Start	End	E-Value	Type
low complexity region	28	46	N/A	INTRINSIC
low complexity region	197	213	N/A	INTRINSIC
low complexity region	314	326	N/A	INTRINSIC
low complexity region	327	348	N/A	INTRINSIC
low complexity region	365	379	N/A	INTRINSIC
low complexity region	407	426	N/A	INTRINSIC
low complexity region	577	609	N/A	INTRINSIC
low complexity region	624	638	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
uDENN	690	781	1.16e-30	SMART
DENN	788	972	7.84e-78	SMART
low complexity region	1007	1014	N/A	INTRINSIC
dDENN	1019	1086	3.12e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000084738
AA Change: V336E

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000081789
Gene: ENSMUSG00000031024
AA Change: V336E

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168005
AA Change: V336E

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000130119
Gene: ENSMUSG00000031024
AA Change: V336E

Domain	Start	End	E-Value	Type
low complexity region	160	192	N/A	INTRINSIC
low complexity region	207	221	N/A	INTRINSIC
low complexity region	228	239	N/A	INTRINSIC
uDENN	273	364	1.16e-30	SMART
DENN	371	555	7.84e-78	SMART
low complexity region	590	597	N/A	INTRINSIC
dDENN	602	669	3.12e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207664

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208557

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its ability to suppress the tumorigenicity of Hela cells in nude mice. The protein encoded by this gene contains a C-terminal region that shares similarity with the Rab 3 family of small GTP binding proteins. This protein preferentially binds to the SH3 domain of c-Abl kinase, and acts as a regulator of MAPK1/ERK2 kinase, which may contribute to its ability to reduce the tumorigenic phenotype in cells. Three alternatively spliced transcript variants of this gene encoding distinct isoforms are identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	A	T	15: 58,028,692	M173K	probably benign	Het
Abcb1b	T	A	5: 8,806,009	F39Y	probably damaging	Het
Acbd3	A	G	1: 180,738,612	Y290C	probably damaging	Het
Alg12	A	C	15: 88,816,149	I28R	possibly damaging	Het
Amer2	A	T	14: 60,379,535	D393V	probably damaging	Het
Anxa5	A	T	3: 36,457,469	V153D	probably damaging	Het
Arl5a	T	C	2: 52,416,129	M64V	probably benign	Het
Armc4	T	A	18: 7,217,800	H638L	probably benign	Het
Astn1	T	C	1: 158,688,548	L1236P	probably damaging	Het
Atg2a	T	C	19: 6,247,683	S424P	possibly damaging	Het
AW551984	A	T	9: 39,599,321	S239R	probably benign	Het
Baz1b	T	C	5: 135,240,131	V1278A	probably benign	Het
Cbfa2t3	G	T	8: 122,635,060	L408I	probably benign	Het
Cdc27	A	T	11: 104,528,424	N227K	possibly damaging	Het
Cdh23	T	A	10: 60,379,315	N1412I	probably damaging	Het
Cdh7	A	T	1: 110,108,756	Q555H	probably damaging	Het
Cdhr2	T	C	13: 54,718,292	S302P	probably benign	Het
Cep350	C	A	1: 155,906,571	E1563D	probably benign	Het
Cfap221	T	A	1: 119,985,023	E107V	probably benign	Het
Col6a3	C	A	1: 90,788,216	R1641L	unknown	Het
Coro6	A	T	11: 77,464,090	I60F	probably benign	Het
Dock10	G	T	1: 80,595,683	N245K	probably damaging	Het
Epb41l2	T	A	10: 25,469,221	N286K	probably damaging	Het
Fam83g	G	T	11: 61,703,109	E490*	probably null	Het
Gm13088	G	T	4: 143,655,501	Y208*	probably null	Het
Gnb1l	T	C	16: 18,552,461	I234T	possibly damaging	Het
Gtf3a	T	A	5: 146,948,937	W53R	probably damaging	Het
Ikzf4	T	C	10: 128,634,407	I415V	probably benign	Het
Il11ra1	T	C	4: 41,767,527	V293A	probably damaging	Het
Il17ra	G	A	6: 120,478,449	V340M	probably benign	Het
Ino80	G	A	2: 119,382,960	R1249C	probably damaging	Het
Kif24	A	T	4: 41,428,731	H76Q	probably benign	Het
Klhl25	T	C	7: 75,866,516	L390P	probably damaging	Het
Klhl26	T	C	8: 70,451,829	D443G	probably damaging	Het
Lama3	A	T	18: 12,507,007	R86S	probably damaging	Het
Lrrc24	G	A	15: 76,715,784	A385V	probably benign	Het
Maea	C	T	5: 33,360,443	A109V	probably benign	Het
Mtor	A	T	4: 148,486,050	Y1188F	probably benign	Het
Nccrp1	T	C	7: 28,544,552	D202G	probably damaging	Het
Nsun4	A	T	4: 116,044,738	L177Q	probably damaging	Het
Nup155	C	T	15: 8,131,543	R571W	probably damaging	Het
Nup160	T	A	2: 90,708,844	M789K	probably benign	Het
Olfr262	A	G	19: 12,241,076	F195S	probably benign	Het
Olfr469	A	T	7: 107,822,917	L184*	probably null	Het
Olfr926	A	T	9: 38,877,185	H3L	probably benign	Het
Pgpep1	G	T	8: 70,652,524		probably null	Het
Pkd1l2	C	T	8: 117,021,850	V1861M	probably benign	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Plin4	G	T	17: 56,104,667	T788K	possibly damaging	Het
Ppp3r2	T	C	4: 49,681,902	D16G	possibly damaging	Het
Prdm16	A	T	4: 154,342,056	I424N	probably damaging	Het
Psen2	T	A	1: 180,228,845	I396F	probably damaging	Het
Psip1	C	T	4: 83,485,712		probably null	Het
Ptprd	G	A	4: 76,136,846	T215I	probably damaging	Het
Rec114	A	G	9: 58,741,539	S2P	probably benign	Het
Rexo1	A	G	10: 80,542,576	I1181T	probably damaging	Het
Rfx7	T	C	9: 72,619,836	M1436T	probably benign	Het
Rnf213	T	A	11: 119,426,111	V1020E	possibly damaging	Het
Rorc	G	A	3: 94,388,762	G83S	probably damaging	Het
Ryr2	T	G	13: 11,668,839	Q3113P	possibly damaging	Het
Shank1	T	C	7: 44,353,977	S1698P	possibly damaging	Het
Slc2a2	T	C	3: 28,708,679		probably null	Het
Slc5a9	A	T	4: 111,891,836	Y98*	probably null	Het
Smc6	T	C	12: 11,283,174		probably null	Het
Sptb	G	T	12: 76,600,383	F1959L	probably benign	Het
Srgap1	T	A	10: 121,785,705	H984L	possibly damaging	Het
Ssc5d	T	A	7: 4,928,467	C224*	probably null	Het
Ston2	A	T	12: 91,647,860	H591Q	probably benign	Het
Tbx3	C	T	5: 119,675,250	A222V	possibly damaging	Het
Thsd7a	A	G	6: 12,321,887		probably null	Het
Usp9y	T	C	Y: 1,364,732	D1027G	probably damaging	Het
Wnt5a	C	T	14: 28,518,504	R184*	probably null	Het
Zfpm2	A	G	15: 40,774,066	E74G	possibly damaging	Het
Zwint	C	A	10: 72,657,295	S223*	probably null	Het

Other mutations in St5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00493:St5	APN	7	109527708	missense	possibly damaging	0.71
IGL01132:St5	APN	7	109570005	splice site	probably null
IGL01288:St5	APN	7	109539822	missense	probably damaging	0.96
IGL01645:St5	APN	7	109527634	nonsense	probably null
IGL01714:St5	APN	7	109570062	missense	probably damaging	0.99
IGL02021:St5	APN	7	109557372	missense	probably damaging	1.00
IGL02302:St5	APN	7	109525331	missense	probably damaging	1.00
IGL02496:St5	APN	7	109556235	missense	possibly damaging	0.83
IGL02795:St5	APN	7	109556364	missense	probably damaging	1.00
Bucolic	UTSW	7	109525548	nonsense	probably null
Halcyon	UTSW	7	109556793	nonsense	probably null
FR4340:St5	UTSW	7	109556921	unclassified	probably benign
FR4737:St5	UTSW	7	109556921	unclassified	probably benign
PIT4466001:St5	UTSW	7	109531130	missense	probably damaging	1.00
PIT4469001:St5	UTSW	7	109531130	missense	probably damaging	1.00
PIT4472001:St5	UTSW	7	109531130	missense	probably damaging	1.00
R0024:St5	UTSW	7	109524659	missense	probably damaging	1.00
R0124:St5	UTSW	7	109542511	missense	possibly damaging	0.66
R0125:St5	UTSW	7	109556338	missense	probably benign	0.19
R0491:St5	UTSW	7	109557204	missense	probably benign	0.45
R0534:St5	UTSW	7	109541428	missense	probably damaging	1.00
R0662:St5	UTSW	7	109557426	missense	probably damaging	1.00
R0743:St5	UTSW	7	109557345	missense	probably damaging	1.00
R0772:St5	UTSW	7	109542320	splice site	probably null
R0774:St5	UTSW	7	109542320	splice site	probably null
R0787:St5	UTSW	7	109525620	missense	possibly damaging	0.94
R0884:St5	UTSW	7	109557345	missense	probably damaging	1.00
R1518:St5	UTSW	7	109557355	missense	probably damaging	1.00
R1908:St5	UTSW	7	109525326	nonsense	probably null
R1909:St5	UTSW	7	109525326	nonsense	probably null
R2232:St5	UTSW	7	109557207	missense	probably benign
R2358:St5	UTSW	7	109556446	missense	probably benign	0.01
R2847:St5	UTSW	7	109525337	missense	probably damaging	1.00
R2869:St5	UTSW	7	109557430	missense	probably benign	0.01
R2869:St5	UTSW	7	109557430	missense	probably benign	0.01
R2870:St5	UTSW	7	109557430	missense	probably benign	0.01
R2870:St5	UTSW	7	109557430	missense	probably benign	0.01
R2871:St5	UTSW	7	109557430	missense	probably benign	0.01
R2871:St5	UTSW	7	109557430	missense	probably benign	0.01
R2873:St5	UTSW	7	109557430	missense	probably benign	0.01
R2874:St5	UTSW	7	109557430	missense	probably benign	0.01
R4534:St5	UTSW	7	109531156	missense	probably damaging	1.00
R4536:St5	UTSW	7	109531156	missense	probably damaging	1.00
R4559:St5	UTSW	7	109525578	missense	probably damaging	1.00
R4798:St5	UTSW	7	109557033	missense	probably damaging	0.99
R4846:St5	UTSW	7	109556836	nonsense	probably null
R5110:St5	UTSW	7	109542490	missense	probably benign	0.02
R5181:St5	UTSW	7	109556790	missense	probably benign
R5268:St5	UTSW	7	109557312	missense	probably benign
R5403:St5	UTSW	7	109556905	missense	probably damaging	1.00
R5836:St5	UTSW	7	109541345	missense	possibly damaging	0.78
R5932:St5	UTSW	7	109570016	missense	probably damaging	1.00
R5937:St5	UTSW	7	109557271	missense	possibly damaging	0.86
R6180:St5	UTSW	7	109556888	missense	probably benign	0.11
R6741:St5	UTSW	7	109545097	missense	possibly damaging	0.95
R6781:St5	UTSW	7	109525304	missense	possibly damaging	0.83
R7086:St5	UTSW	7	109525574	missense	probably damaging	1.00
R7466:St5	UTSW	7	109525346	missense	probably damaging	1.00
R7644:St5	UTSW	7	109556793	nonsense	probably null
R8354:St5	UTSW	7	109525548	nonsense	probably null
R8745:St5	UTSW	7	109557072	missense	probably benign	0.02
R8859:St5	UTSW	7	109524656	missense	probably damaging	1.00
RF062:St5	UTSW	7	109556946	unclassified	probably benign
X0067:St5	UTSW	7	109556240	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATGAAGAACACTCAGGACGTGCC -3'
(R):5'- AGGAGATGCCTTTCAGTCCCTCTAC -3'

Sequencing Primer
(F):5'- aggaaggaaggaaggaaagaaag -3'
(R):5'- TACCCCTACTGCCCCAGG -3'

Posted On

2013-05-09