Mutagenetix > Incidental Mutations

Incidental Mutation 'R0365:Wnt5a'

36372

Institutional Source

Beutler Lab

Gene Symbol

Wnt5a

Ensembl Gene

ENSMUSG00000021994

Gene Name

wingless-type MMTV integration site family, member 5A

Synonyms

8030457G12Rik, Wnt-5a

MMRRC Submission

038571-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0365 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

28504750-28527448 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 28518504 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 184 (R184*)

Ref Sequence

ENSEMBL: ENSMUSP00000107891 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063465] [ENSMUST00000112272]

Predicted Effect

probably null
Transcript: ENSMUST00000063465
AA Change: R204*

SMART Domains

Protein: ENSMUSP00000064878
Gene: ENSMUSG00000021994
AA Change: R204*

Domain	Start	End	E-Value	Type
Blast:WNT1	1	46	7e-6	BLAST
WNT1	71	380	6.71e-222	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000112272
AA Change: R184*

SMART Domains

Protein: ENSMUSP00000107891
Gene: ENSMUSG00000021994
AA Change: R184*

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WNT1	51	360	6.71e-222	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134163

Coding Region Coverage

1x: 99.4%
3x: 98.6%
10x: 96.7%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The WNT gene family consists of structurally related genes which encode secreted signaling proteins. These proteins have been implicated in oncogenesis and in several developmental processes, including regulation of cell fate and patterning during embryogenesis. This gene encodes a member of the WNT family that signals through both the canonical and non-canonical WNT pathways. This protein is a ligand for the seven transmembrane receptor frizzled-5 and the tyrosine kinase orphan receptor 2. This protein plays an essential role in regulating developmental pathways during embryogenesis. This protein may also play a role in oncogenesis. Mutations in this gene are the cause of autosomal dominant Robinow syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous mutants exhibit caudal truncation with shortened anterior-posterior axis, truncation of the snout, tongue and mandible, short fore- and hindlimbs, which lack digits, absent genital tubercle and lung abnormalities. Mutants die perinatally. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130401M01Rik	A	T	15: 58,028,692	M173K	probably benign	Het
Abcb1b	T	A	5: 8,806,009	F39Y	probably damaging	Het
Acbd3	A	G	1: 180,738,612	Y290C	probably damaging	Het
Alg12	A	C	15: 88,816,149	I28R	possibly damaging	Het
Amer2	A	T	14: 60,379,535	D393V	probably damaging	Het
Anxa5	A	T	3: 36,457,469	V153D	probably damaging	Het
Arl5a	T	C	2: 52,416,129	M64V	probably benign	Het
Armc4	T	A	18: 7,217,800	H638L	probably benign	Het
Astn1	T	C	1: 158,688,548	L1236P	probably damaging	Het
Atg2a	T	C	19: 6,247,683	S424P	possibly damaging	Het
AW551984	A	T	9: 39,599,321	S239R	probably benign	Het
Baz1b	T	C	5: 135,240,131	V1278A	probably benign	Het
Cbfa2t3	G	T	8: 122,635,060	L408I	probably benign	Het
Cdc27	A	T	11: 104,528,424	N227K	possibly damaging	Het
Cdh23	T	A	10: 60,379,315	N1412I	probably damaging	Het
Cdh7	A	T	1: 110,108,756	Q555H	probably damaging	Het
Cdhr2	T	C	13: 54,718,292	S302P	probably benign	Het
Cep350	C	A	1: 155,906,571	E1563D	probably benign	Het
Cfap221	T	A	1: 119,985,023	E107V	probably benign	Het
Col6a3	C	A	1: 90,788,216	R1641L	unknown	Het
Coro6	A	T	11: 77,464,090	I60F	probably benign	Het
Dock10	G	T	1: 80,595,683	N245K	probably damaging	Het
Epb41l2	T	A	10: 25,469,221	N286K	probably damaging	Het
Fam83g	G	T	11: 61,703,109	E490*	probably null	Het
Gm13088	G	T	4: 143,655,501	Y208*	probably null	Het
Gnb1l	T	C	16: 18,552,461	I234T	possibly damaging	Het
Gtf3a	T	A	5: 146,948,937	W53R	probably damaging	Het
Ikzf4	T	C	10: 128,634,407	I415V	probably benign	Het
Il11ra1	T	C	4: 41,767,527	V293A	probably damaging	Het
Il17ra	G	A	6: 120,478,449	V340M	probably benign	Het
Ino80	G	A	2: 119,382,960	R1249C	probably damaging	Het
Kif24	A	T	4: 41,428,731	H76Q	probably benign	Het
Klhl25	T	C	7: 75,866,516	L390P	probably damaging	Het
Klhl26	T	C	8: 70,451,829	D443G	probably damaging	Het
Lama3	A	T	18: 12,507,007	R86S	probably damaging	Het
Lrrc24	G	A	15: 76,715,784	A385V	probably benign	Het
Maea	C	T	5: 33,360,443	A109V	probably benign	Het
Mtor	A	T	4: 148,486,050	Y1188F	probably benign	Het
Nccrp1	T	C	7: 28,544,552	D202G	probably damaging	Het
Nsun4	A	T	4: 116,044,738	L177Q	probably damaging	Het
Nup155	C	T	15: 8,131,543	R571W	probably damaging	Het
Nup160	T	A	2: 90,708,844	M789K	probably benign	Het
Olfr262	A	G	19: 12,241,076	F195S	probably benign	Het
Olfr469	A	T	7: 107,822,917	L184*	probably null	Het
Olfr926	A	T	9: 38,877,185	H3L	probably benign	Het
Pgpep1	G	T	8: 70,652,524		probably null	Het
Pkd1l2	C	T	8: 117,021,850	V1861M	probably benign	Het
Plekha5	G	A	6: 140,591,747	R646K	possibly damaging	Het
Plin4	G	T	17: 56,104,667	T788K	possibly damaging	Het
Ppp3r2	T	C	4: 49,681,902	D16G	possibly damaging	Het
Prdm16	A	T	4: 154,342,056	I424N	probably damaging	Het
Psen2	T	A	1: 180,228,845	I396F	probably damaging	Het
Psip1	C	T	4: 83,485,712		probably null	Het
Ptprd	G	A	4: 76,136,846	T215I	probably damaging	Het
Rec114	A	G	9: 58,741,539	S2P	probably benign	Het
Rexo1	A	G	10: 80,542,576	I1181T	probably damaging	Het
Rfx7	T	C	9: 72,619,836	M1436T	probably benign	Het
Rnf213	T	A	11: 119,426,111	V1020E	possibly damaging	Het
Rorc	G	A	3: 94,388,762	G83S	probably damaging	Het
Ryr2	T	G	13: 11,668,839	Q3113P	possibly damaging	Het
Shank1	T	C	7: 44,353,977	S1698P	possibly damaging	Het
Slc2a2	T	C	3: 28,708,679		probably null	Het
Slc5a9	A	T	4: 111,891,836	Y98*	probably null	Het
Smc6	T	C	12: 11,283,174		probably null	Het
Sptb	G	T	12: 76,600,383	F1959L	probably benign	Het
Srgap1	T	A	10: 121,785,705	H984L	possibly damaging	Het
Ssc5d	T	A	7: 4,928,467	C224*	probably null	Het
St5	A	T	7: 109,538,949	V753E	probably damaging	Het
Ston2	A	T	12: 91,647,860	H591Q	probably benign	Het
Tbx3	C	T	5: 119,675,250	A222V	possibly damaging	Het
Thsd7a	A	G	6: 12,321,887		probably null	Het
Usp9y	T	C	Y: 1,364,732	D1027G	probably damaging	Het
Zfpm2	A	G	15: 40,774,066	E74G	possibly damaging	Het
Zwint	C	A	10: 72,657,295	S223*	probably null	Het

Other mutations in Wnt5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00959:Wnt5a	APN	14	28522909	missense	probably damaging	1.00
IGL01945:Wnt5a	APN	14	28518562	missense	probably damaging	1.00
IGL02117:Wnt5a	APN	14	28506120	splice site	probably benign
IGL02995:Wnt5a	APN	14	28522914	missense	probably benign	0.02
IGL03123:Wnt5a	APN	14	28522925	missense	probably damaging	1.00
Thrush	UTSW	14	28518463	missense	possibly damaging	0.78
R0254:Wnt5a	UTSW	14	28522854	missense	probably damaging	1.00
R0277:Wnt5a	UTSW	14	28513268	missense	possibly damaging	0.74
R1472:Wnt5a	UTSW	14	28518504	nonsense	probably null
R1661:Wnt5a	UTSW	14	28518343	missense	probably benign	0.02
R1662:Wnt5a	UTSW	14	28518343	missense	probably benign	0.02
R1762:Wnt5a	UTSW	14	28522891	missense	probably damaging	1.00
R1791:Wnt5a	UTSW	14	28511878	start codon destroyed	probably null	0.00
R1933:Wnt5a	UTSW	14	28511845	missense	probably benign	0.00
R2147:Wnt5a	UTSW	14	28513317	missense	probably damaging	1.00
R2149:Wnt5a	UTSW	14	28513317	missense	probably damaging	1.00
R3078:Wnt5a	UTSW	14	28513183	nonsense	probably null
R3162:Wnt5a	UTSW	14	28522488	missense	probably benign	0.00
R3162:Wnt5a	UTSW	14	28522488	missense	probably benign	0.00
R4237:Wnt5a	UTSW	14	28522866	missense	probably damaging	1.00
R5396:Wnt5a	UTSW	14	28522770	missense	probably damaging	1.00
R6329:Wnt5a	UTSW	14	28518492	nonsense	probably null
R6698:Wnt5a	UTSW	14	28518463	missense	possibly damaging	0.78
R6974:Wnt5a	UTSW	14	28522570	missense	possibly damaging	0.89
R7114:Wnt5a	UTSW	14	28522756	missense	probably damaging	1.00
R7232:Wnt5a	UTSW	14	28518372	missense	probably benign	0.03
R7666:Wnt5a	UTSW	14	28518372	missense	possibly damaging	0.88
T0722:Wnt5a	UTSW	14	28511925	missense	probably benign	0.01
Z1088:Wnt5a	UTSW	14	28522728	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTGACCCCTCATCCTTAATCGCAG -3'
(R):5'- ACAGATAGGCCAAGGTATGAGTATCCG -3'

Sequencing Primer
(F):5'- TCCTTAATCGCAGGCAGC -3'
(R):5'- ACCTGAACTGAGGGGGC -3'

Posted On

2013-05-09