Incidental Mutation 'R0366:Setd7'
ID36398
Institutional Source Beutler Lab
Gene Symbol Setd7
Ensembl Gene ENSMUSG00000037111
Gene NameSET domain containing (lysine methyltransferase) 7
SynonymsKMT7, Set7, 1600028F23Rik, Set7/9
MMRRC Submission 038572-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0366 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location51515319-51560879 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51550320 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 29 (T29A)
Ref Sequence ENSEMBL: ENSMUSP00000043492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037141]
Predicted Effect probably benign
Transcript: ENSMUST00000037141
AA Change: T29A

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000043492
Gene: ENSMUSG00000037111
AA Change: T29A

DomainStartEndE-ValueType
Pfam:MORN 13 35 9e-3 PFAM
Pfam:MORN 36 58 1.7e-6 PFAM
Pfam:MORN 60 81 1.6e-6 PFAM
Pfam:MORN 106 128 2.2e-6 PFAM
SET 214 342 2.35e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194828
Meta Mutation Damage Score 0.0629 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Homozygotes for a knock-out allele exhibit partial prenatal lethality and failure of mouse embryonic fibroblasts and spleen cells to arrest after doxorubicin treatment. Homozygotes for a different knock-out allele show resistance to bleomycin- or adenovirus-TGFbeta-induced pulmonary fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G T 17: 46,324,798 S93* probably null Het
Ackr2 T C 9: 121,909,360 L267P probably damaging Het
Adgre4 T A 17: 55,792,001 L169* probably null Het
AI481877 A C 4: 59,099,410 M94R probably benign Het
Ankrd12 T A 17: 65,984,506 S1311C possibly damaging Het
Arid2 T A 15: 96,361,720 probably benign Het
Atp9b A T 18: 80,762,102 V747E probably damaging Het
Best1 T C 19: 9,992,053 probably null Het
Brwd1 C A 16: 96,037,964 E836* probably null Het
Cachd1 A G 4: 100,994,737 S1177G possibly damaging Het
Cacna1e C T 1: 154,416,138 E1766K probably benign Het
Cckar A G 5: 53,700,165 I301T probably benign Het
Cdc27 T G 11: 104,505,648 T816P probably damaging Het
Cep162 T G 9: 87,220,484 Q708H probably damaging Het
Cep250 C A 2: 155,988,401 D1301E probably benign Het
D430041D05Rik G A 2: 104,255,340 H955Y probably damaging Het
Dcdc2a T A 13: 25,056,434 V55E probably damaging Het
Efcab12 A G 6: 115,823,248 probably benign Het
Ep400 A G 5: 110,701,671 V1428A unknown Het
Erbb3 T C 10: 128,572,570 E825G possibly damaging Het
Evl A T 12: 108,686,048 probably null Het
Fuca2 G A 10: 13,505,763 R140H probably benign Het
Gm4969 T A 7: 19,107,039 I57F probably damaging Het
Gm5581 T C 6: 131,166,447 noncoding transcript Het
Gm7052 T C 17: 22,040,517 probably benign Het
Gpd1 T G 15: 99,719,270 I119S probably damaging Het
Gzmc A T 14: 56,232,736 Y101* probably null Het
Hmcn2 G T 2: 31,424,206 A3588S possibly damaging Het
Ikbkb A G 8: 22,695,260 probably benign Het
Itgax G T 7: 128,149,089 probably benign Het
Kif24 C A 4: 41,428,717 S81I possibly damaging Het
Lct G A 1: 128,286,462 P1858S probably benign Het
Map2k1 C A 9: 64,193,702 probably null Het
Mdga1 A G 17: 29,857,708 V30A possibly damaging Het
Mtcl1 G A 17: 66,338,129 P1441L probably damaging Het
N4bp2 T A 5: 65,806,396 F596Y possibly damaging Het
Notch4 A T 17: 34,581,499 probably benign Het
Olfr1061 A G 2: 86,414,025 V9A possibly damaging Het
Olfr1259 A C 2: 89,943,818 V99G possibly damaging Het
Olfr167 A G 16: 19,514,848 S263P probably benign Het
Olfr802 A G 10: 129,681,971 M256T possibly damaging Het
Olfr907 T A 9: 38,499,154 C162S possibly damaging Het
Pbld2 A G 10: 63,053,957 probably benign Het
Phip T C 9: 82,926,407 Y505C probably damaging Het
Plcb2 A G 2: 118,724,447 F58L probably benign Het
Plcd1 T A 9: 119,081,136 I72F probably damaging Het
Ppp5c A T 7: 17,022,583 Y63* probably null Het
Prdm4 T C 10: 85,908,004 D129G probably damaging Het
Prkcq C A 2: 11,246,838 probably benign Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rab7b T A 1: 131,698,504 V90D probably damaging Het
Ripk3 T C 14: 55,786,835 T193A probably damaging Het
Rnf167 C T 11: 70,649,317 R88* probably null Het
Robo1 A G 16: 72,742,245 T59A possibly damaging Het
Scd2 G A 19: 44,301,246 V227I probably benign Het
Scg3 T A 9: 75,675,338 probably benign Het
Sec31a A T 5: 100,382,766 L677H probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Slc4a5 A G 6: 83,295,872 Y942C probably benign Het
Slit1 T A 19: 41,611,031 Y1027F probably damaging Het
Sptan1 G A 2: 29,992,752 probably null Het
Tdrd12 T C 7: 35,508,802 Q249R probably benign Het
Tmem171 T A 13: 98,692,228 D138V possibly damaging Het
Ttll10 G A 4: 156,035,155 R596W probably damaging Het
Usp53 G T 3: 122,949,201 N695K probably damaging Het
Vmn2r25 A T 6: 123,823,622 L587* probably null Het
Zglp1 C T 9: 21,063,379 C171Y probably benign Het
Other mutations in Setd7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Setd7 APN 3 51550308 missense probably benign 0.00
IGL00940:Setd7 APN 3 51533038 missense probably damaging 1.00
IGL00943:Setd7 APN 3 51533038 missense probably damaging 1.00
IGL00944:Setd7 APN 3 51533038 missense probably damaging 1.00
IGL01466:Setd7 APN 3 51521309 makesense probably null
IGL01810:Setd7 APN 3 51532967 splice site probably benign
IGL01884:Setd7 APN 3 51542711 missense possibly damaging 0.71
IGL02117:Setd7 APN 3 51521405 missense probably damaging 1.00
IGL02806:Setd7 APN 3 51550267 missense probably damaging 0.97
IGL03258:Setd7 APN 3 51560515 splice site probably null
IGL03404:Setd7 APN 3 51532986 nonsense probably null
R1328:Setd7 UTSW 3 51542819 missense possibly damaging 0.95
R1819:Setd7 UTSW 3 51542639 missense probably benign 0.38
R1872:Setd7 UTSW 3 51542831 missense probably benign 0.29
R2406:Setd7 UTSW 3 51542676 missense probably damaging 0.99
R2513:Setd7 UTSW 3 51533015 missense probably damaging 1.00
R4231:Setd7 UTSW 3 51542730 missense probably benign 0.24
R4627:Setd7 UTSW 3 51542665 missense probably damaging 0.99
R4687:Setd7 UTSW 3 51550355 missense probably damaging 1.00
R4770:Setd7 UTSW 3 51521422 missense probably damaging 1.00
R5212:Setd7 UTSW 3 51542817 missense probably damaging 1.00
R5472:Setd7 UTSW 3 51521465 missense probably benign 0.00
R6127:Setd7 UTSW 3 51530081 missense probably damaging 1.00
R6647:Setd7 UTSW 3 51542762 missense probably benign 0.00
R6966:Setd7 UTSW 3 51530184 missense probably damaging 1.00
R7744:Setd7 UTSW 3 51526840 splice site probably null
R7828:Setd7 UTSW 3 51536657 critical splice acceptor site probably null
R7896:Setd7 UTSW 3 51536656 critical splice acceptor site probably null
R7979:Setd7 UTSW 3 51536656 critical splice acceptor site probably null
X0022:Setd7 UTSW 3 51542652 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- GCATATACGATGGGGTTGCTCTCAC -3'
(R):5'- GTATGGACCAGCCAGTTCACGAAG -3'

Sequencing Primer
(F):5'- GCATGAGTTACACACAAGCTTTC -3'
(R):5'- tcagcagctaggggcac -3'
Posted On2013-05-09