Incidental Mutation 'R0366:Sec31a'
ID36406
Institutional Source Beutler Lab
Gene Symbol Sec31a
Ensembl Gene ENSMUSG00000035325
Gene NameSec31 homolog A (S. cerevisiae)
SynonymsSec31l1, 1810024J13Rik
MMRRC Submission 038572-MU
Accession Numbers

Genbank: NM_026969; MGI: 1916412; Ensembl: ENSMUST00000046296, ENSMUST00000094578, ENSMUST00000112918

Is this an essential gene? Probably essential (E-score: 0.830) question?
Stock #R0366 (G1)
Quality Score206
Status Validated
Chromosome5
Chromosomal Location100361649-100416234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 100382766 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 677 (L677H)
Ref Sequence ENSEMBL: ENSMUSP00000138213 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094578] [ENSMUST00000182886] [ENSMUST00000183247]
Predicted Effect probably damaging
Transcript: ENSMUST00000094578
AA Change: L716H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092157
Gene: ENSMUSG00000035325
AA Change: L716H

DomainStartEndE-ValueType
WD40 56 102 1.59e1 SMART
WD40 111 151 5.15e-2 SMART
WD40 158 197 5.16e-1 SMART
WD40 200 245 6.63e0 SMART
WD40 249 289 1.95e-2 SMART
WD40 292 332 4.24e-3 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 572 769 3.5e-7 PFAM
low complexity region 866 882 N/A INTRINSIC
low complexity region 930 949 N/A INTRINSIC
low complexity region 953 975 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182569
Predicted Effect unknown
Transcript: ENSMUST00000182812
AA Change: L27H
Predicted Effect probably damaging
Transcript: ENSMUST00000182886
AA Change: L677H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138213
Gene: ENSMUSG00000035325
AA Change: L677H

DomainStartEndE-ValueType
WD40 56 102 1e-1 SMART
WD40 111 151 3.3e-4 SMART
WD40 158 197 3.2e-3 SMART
WD40 200 245 4.1e-2 SMART
WD40 249 289 1.2e-4 SMART
WD40 292 332 2.6e-5 SMART
low complexity region 363 373 N/A INTRINSIC
Pfam:Sec16_C 532 731 2.1e-6 PFAM
low complexity region 827 843 N/A INTRINSIC
low complexity region 891 910 N/A INTRINSIC
low complexity region 914 936 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000182988
AA Change: L416H
Predicted Effect probably benign
Transcript: ENSMUST00000183247
SMART Domains Protein: ENSMUSP00000138129
Gene: ENSMUSG00000035325

DomainStartEndE-ValueType
Pfam:Sec16_C 141 248 1.5e-7 PFAM
Meta Mutation Damage Score 0.9609 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with the yeast Sec31 protein, and is a component of the outer layer of the coat protein complex II (COPII). The encoded protein is involved in vesicle budding from the endoplasmic reticulum (ER) and contains multiple WD repeats near the N-terminus and a proline-rich region in the C-terminal half. It associates with the protein encoded by the SEC13 homolog, nuclear pore and COPII coat complex component (SEC13), and is required for ER-Golgi transport. Monoubiquitylation of this protein by CUL3-KLHL12 was found to regulate the size of COPII coats to accommodate unusually shaped cargo. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI

All alleles(31) : Gene trapped(31)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G T 17: 46,324,798 S93* probably null Het
Ackr2 T C 9: 121,909,360 L267P probably damaging Het
Adgre4 T A 17: 55,792,001 L169* probably null Het
AI481877 A C 4: 59,099,410 M94R probably benign Het
Ankrd12 T A 17: 65,984,506 S1311C possibly damaging Het
Arid2 T A 15: 96,361,720 probably benign Het
Atp9b A T 18: 80,762,102 V747E probably damaging Het
Best1 T C 19: 9,992,053 probably null Het
Brwd1 C A 16: 96,037,964 E836* probably null Het
Cachd1 A G 4: 100,994,737 S1177G possibly damaging Het
Cacna1e C T 1: 154,416,138 E1766K probably benign Het
Cckar A G 5: 53,700,165 I301T probably benign Het
Cdc27 T G 11: 104,505,648 T816P probably damaging Het
Cep162 T G 9: 87,220,484 Q708H probably damaging Het
Cep250 C A 2: 155,988,401 D1301E probably benign Het
D430041D05Rik G A 2: 104,255,340 H955Y probably damaging Het
Dcdc2a T A 13: 25,056,434 V55E probably damaging Het
Efcab12 A G 6: 115,823,248 probably benign Het
Ep400 A G 5: 110,701,671 V1428A unknown Het
Erbb3 T C 10: 128,572,570 E825G possibly damaging Het
Evl A T 12: 108,686,048 probably null Het
Fuca2 G A 10: 13,505,763 R140H probably benign Het
Gm4969 T A 7: 19,107,039 I57F probably damaging Het
Gm5581 T C 6: 131,166,447 noncoding transcript Het
Gm7052 T C 17: 22,040,517 probably benign Het
Gpd1 T G 15: 99,719,270 I119S probably damaging Het
Gzmc A T 14: 56,232,736 Y101* probably null Het
Hmcn2 G T 2: 31,424,206 A3588S possibly damaging Het
Ikbkb A G 8: 22,695,260 probably benign Het
Itgax G T 7: 128,149,089 probably benign Het
Kif24 C A 4: 41,428,717 S81I possibly damaging Het
Lct G A 1: 128,286,462 P1858S probably benign Het
Map2k1 C A 9: 64,193,702 probably null Het
Mdga1 A G 17: 29,857,708 V30A possibly damaging Het
Mtcl1 G A 17: 66,338,129 P1441L probably damaging Het
N4bp2 T A 5: 65,806,396 F596Y possibly damaging Het
Notch4 A T 17: 34,581,499 probably benign Het
Olfr1061 A G 2: 86,414,025 V9A possibly damaging Het
Olfr1259 A C 2: 89,943,818 V99G possibly damaging Het
Olfr167 A G 16: 19,514,848 S263P probably benign Het
Olfr802 A G 10: 129,681,971 M256T possibly damaging Het
Olfr907 T A 9: 38,499,154 C162S possibly damaging Het
Pbld2 A G 10: 63,053,957 probably benign Het
Phip T C 9: 82,926,407 Y505C probably damaging Het
Plcb2 A G 2: 118,724,447 F58L probably benign Het
Plcd1 T A 9: 119,081,136 I72F probably damaging Het
Ppp5c A T 7: 17,022,583 Y63* probably null Het
Prdm4 T C 10: 85,908,004 D129G probably damaging Het
Prkcq C A 2: 11,246,838 probably benign Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rab7b T A 1: 131,698,504 V90D probably damaging Het
Ripk3 T C 14: 55,786,835 T193A probably damaging Het
Rnf167 C T 11: 70,649,317 R88* probably null Het
Robo1 A G 16: 72,742,245 T59A possibly damaging Het
Scd2 G A 19: 44,301,246 V227I probably benign Het
Scg3 T A 9: 75,675,338 probably benign Het
Sema6a G A 18: 47,290,045 probably null Het
Setd7 T C 3: 51,550,320 T29A probably benign Het
Slc4a5 A G 6: 83,295,872 Y942C probably benign Het
Slit1 T A 19: 41,611,031 Y1027F probably damaging Het
Sptan1 G A 2: 29,992,752 probably null Het
Tdrd12 T C 7: 35,508,802 Q249R probably benign Het
Tmem171 T A 13: 98,692,228 D138V possibly damaging Het
Ttll10 G A 4: 156,035,155 R596W probably damaging Het
Usp53 G T 3: 122,949,201 N695K probably damaging Het
Vmn2r25 A T 6: 123,823,622 L587* probably null Het
Zglp1 C T 9: 21,063,379 C171Y probably benign Het
Other mutations in Sec31a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Sec31a APN 5 100404017 nonsense probably null
IGL01610:Sec31a APN 5 100402358 splice site probably benign
IGL01804:Sec31a APN 5 100375206 critical splice donor site probably null
IGL02026:Sec31a APN 5 100369626 missense probably benign 0.04
IGL02150:Sec31a APN 5 100386125 splice site probably benign
IGL02237:Sec31a APN 5 100362055 missense probably damaging 1.00
IGL02469:Sec31a APN 5 100385255 missense probably benign 0.02
IGL02512:Sec31a APN 5 100407193 missense probably damaging 0.99
control UTSW 5 100362173 missense probably damaging 1.00
Discipline UTSW 5 100363878 missense probably damaging 1.00
D3080:Sec31a UTSW 5 100363832 missense probably damaging 1.00
PIT4142001:Sec31a UTSW 5 100407275 missense probably damaging 1.00
R0453:Sec31a UTSW 5 100404118 splice site probably benign
R0511:Sec31a UTSW 5 100375240 missense probably benign 0.01
R0546:Sec31a UTSW 5 100404070 missense probably damaging 1.00
R0675:Sec31a UTSW 5 100393207 missense probably damaging 0.97
R0678:Sec31a UTSW 5 100407225 missense possibly damaging 0.74
R0975:Sec31a UTSW 5 100395904 unclassified probably null
R1146:Sec31a UTSW 5 100362173 missense probably damaging 1.00
R1146:Sec31a UTSW 5 100362173 missense probably damaging 1.00
R1540:Sec31a UTSW 5 100375319 missense probably damaging 1.00
R1616:Sec31a UTSW 5 100386195 missense possibly damaging 0.88
R1780:Sec31a UTSW 5 100381336 splice site probably null
R2472:Sec31a UTSW 5 100385205 missense probably damaging 1.00
R3689:Sec31a UTSW 5 100382907 missense probably damaging 1.00
R4515:Sec31a UTSW 5 100365958 missense probably damaging 0.99
R4801:Sec31a UTSW 5 100393363 missense probably damaging 0.96
R4802:Sec31a UTSW 5 100393363 missense probably damaging 0.96
R4896:Sec31a UTSW 5 100368333 missense probably damaging 1.00
R5004:Sec31a UTSW 5 100368333 missense probably damaging 1.00
R5053:Sec31a UTSW 5 100393214 missense possibly damaging 0.94
R5158:Sec31a UTSW 5 100393321 missense probably damaging 0.99
R5191:Sec31a UTSW 5 100405511 missense possibly damaging 0.75
R5222:Sec31a UTSW 5 100382895 missense probably benign
R5405:Sec31a UTSW 5 100383798 nonsense probably null
R5436:Sec31a UTSW 5 100363839 missense probably damaging 0.98
R5577:Sec31a UTSW 5 100402274 missense possibly damaging 0.95
R6005:Sec31a UTSW 5 100363878 missense probably damaging 1.00
R6184:Sec31a UTSW 5 100369594 critical splice donor site probably null
R6245:Sec31a UTSW 5 100386184 missense probably benign 0.07
R6475:Sec31a UTSW 5 100385270 missense probably damaging 1.00
R6476:Sec31a UTSW 5 100386149 missense probably benign 0.03
R6744:Sec31a UTSW 5 100392499 missense possibly damaging 0.47
R6804:Sec31a UTSW 5 100382812 missense probably benign 0.03
R6911:Sec31a UTSW 5 100393264 missense possibly damaging 0.92
R6936:Sec31a UTSW 5 100392510 missense probably benign
R7345:Sec31a UTSW 5 100385270 missense probably damaging 1.00
R7760:Sec31a UTSW 5 100392628 missense probably damaging 1.00
R7898:Sec31a UTSW 5 100399477 missense probably damaging 0.99
R8088:Sec31a UTSW 5 100378862 missense
X0003:Sec31a UTSW 5 100399354 missense probably damaging 0.98
Z1177:Sec31a UTSW 5 100383845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGCCAGAGGTAGGAGCTTAAAGG -3'
(R):5'- CGAATGTACTTGCTGGAGAGCAGAG -3'

Sequencing Primer
(F):5'- AAACCGTGGGCTTCTTTCAG -3'
(R):5'- GTCCTAGACTTTACTGGCTGTAAATC -3'
Posted On2013-05-09