Incidental Mutation 'R0366:Best1'
ID36451
Institutional Source Beutler Lab
Gene Symbol Best1
Ensembl Gene ENSMUSG00000037418
Gene Namebestrophin 1
Synonymsbest macular dystrophy, mBest1, Vmd2
MMRRC Submission 038572-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0366 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location9985174-10001633 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 9992053 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117346]
Predicted Effect probably null
Transcript: ENSMUST00000117346
SMART Domains Protein: ENSMUSP00000113053
Gene: ENSMUSG00000037418

DomainStartEndE-ValueType
Pfam:Bestrophin 8 316 8.5e-111 PFAM
low complexity region 476 488 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144273
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the bestrophin gene family. This small gene family is characterized by proteins with a highly conserved N-terminus with four to six transmembrane domains. Bestrophins may form chloride ion channels or may regulate voltage-gated L-type calcium-ion channels. Bestrophins are generally believed to form calcium-activated chloride-ion channels in epithelial cells but they have also been shown to be highly permeable to bicarbonate ion transport in retinal tissue. Mutations in this gene are responsible for juvenile-onset vitelliform macular dystrophy (VMD2), also known as Best macular dystrophy, in addition to adult-onset vitelliform macular dystrophy (AVMD) and other retinopathies. Alternative splicing results in multiple variants encoding distinct isoforms.[provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygous null mutations of this gene generally result in abnormal retinal pigment epithelium morphology and/or altered eye electrophysiology. Homozygotes for a null allele show male subfertility associated with abnormal sperm morphology and reduced motility in the absence of retinal pathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G T 17: 46,324,798 S93* probably null Het
Ackr2 T C 9: 121,909,360 L267P probably damaging Het
Adgre4 T A 17: 55,792,001 L169* probably null Het
AI481877 A C 4: 59,099,410 M94R probably benign Het
Ankrd12 T A 17: 65,984,506 S1311C possibly damaging Het
Arid2 T A 15: 96,361,720 probably benign Het
Atp9b A T 18: 80,762,102 V747E probably damaging Het
Brwd1 C A 16: 96,037,964 E836* probably null Het
Cachd1 A G 4: 100,994,737 S1177G possibly damaging Het
Cacna1e C T 1: 154,416,138 E1766K probably benign Het
Cckar A G 5: 53,700,165 I301T probably benign Het
Cdc27 T G 11: 104,505,648 T816P probably damaging Het
Cep162 T G 9: 87,220,484 Q708H probably damaging Het
Cep250 C A 2: 155,988,401 D1301E probably benign Het
D430041D05Rik G A 2: 104,255,340 H955Y probably damaging Het
Dcdc2a T A 13: 25,056,434 V55E probably damaging Het
Efcab12 A G 6: 115,823,248 probably benign Het
Ep400 A G 5: 110,701,671 V1428A unknown Het
Erbb3 T C 10: 128,572,570 E825G possibly damaging Het
Evl A T 12: 108,686,048 probably null Het
Fuca2 G A 10: 13,505,763 R140H probably benign Het
Gm4969 T A 7: 19,107,039 I57F probably damaging Het
Gm5581 T C 6: 131,166,447 noncoding transcript Het
Gm7052 T C 17: 22,040,517 probably benign Het
Gpd1 T G 15: 99,719,270 I119S probably damaging Het
Gzmc A T 14: 56,232,736 Y101* probably null Het
Hmcn2 G T 2: 31,424,206 A3588S possibly damaging Het
Ikbkb A G 8: 22,695,260 probably benign Het
Itgax G T 7: 128,149,089 probably benign Het
Kif24 C A 4: 41,428,717 S81I possibly damaging Het
Lct G A 1: 128,286,462 P1858S probably benign Het
Map2k1 C A 9: 64,193,702 probably null Het
Mdga1 A G 17: 29,857,708 V30A possibly damaging Het
Mtcl1 G A 17: 66,338,129 P1441L probably damaging Het
N4bp2 T A 5: 65,806,396 F596Y possibly damaging Het
Notch4 A T 17: 34,581,499 probably benign Het
Olfr1061 A G 2: 86,414,025 V9A possibly damaging Het
Olfr1259 A C 2: 89,943,818 V99G possibly damaging Het
Olfr167 A G 16: 19,514,848 S263P probably benign Het
Olfr802 A G 10: 129,681,971 M256T possibly damaging Het
Olfr907 T A 9: 38,499,154 C162S possibly damaging Het
Pbld2 A G 10: 63,053,957 probably benign Het
Phip T C 9: 82,926,407 Y505C probably damaging Het
Plcb2 A G 2: 118,724,447 F58L probably benign Het
Plcd1 T A 9: 119,081,136 I72F probably damaging Het
Ppp5c A T 7: 17,022,583 Y63* probably null Het
Prdm4 T C 10: 85,908,004 D129G probably damaging Het
Prkcq C A 2: 11,246,838 probably benign Het
Rab5b C T 10: 128,682,903 R120Q probably benign Het
Rab7b T A 1: 131,698,504 V90D probably damaging Het
Ripk3 T C 14: 55,786,835 T193A probably damaging Het
Rnf167 C T 11: 70,649,317 R88* probably null Het
Robo1 A G 16: 72,742,245 T59A possibly damaging Het
Scd2 G A 19: 44,301,246 V227I probably benign Het
Scg3 T A 9: 75,675,338 probably benign Het
Sec31a A T 5: 100,382,766 L677H probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Setd7 T C 3: 51,550,320 T29A probably benign Het
Slc4a5 A G 6: 83,295,872 Y942C probably benign Het
Slit1 T A 19: 41,611,031 Y1027F probably damaging Het
Sptan1 G A 2: 29,992,752 probably null Het
Tdrd12 T C 7: 35,508,802 Q249R probably benign Het
Tmem171 T A 13: 98,692,228 D138V possibly damaging Het
Ttll10 G A 4: 156,035,155 R596W probably damaging Het
Usp53 G T 3: 122,949,201 N695K probably damaging Het
Vmn2r25 A T 6: 123,823,622 L587* probably null Het
Zglp1 C T 9: 21,063,379 C171Y probably benign Het
Other mutations in Best1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Best1 APN 19 9986735 missense probably benign 0.22
IGL02129:Best1 APN 19 9992921 missense probably benign
IGL02310:Best1 APN 19 9989152 missense probably benign 0.00
IGL02470:Best1 APN 19 9992976 missense probably benign 0.43
IGL02505:Best1 APN 19 9989150 missense probably damaging 1.00
R1476:Best1 UTSW 19 9990489 nonsense probably null
R1674:Best1 UTSW 19 9993226 critical splice donor site probably null
R2091:Best1 UTSW 19 9992079 missense probably benign 0.27
R2516:Best1 UTSW 19 9993311 nonsense probably null
R2866:Best1 UTSW 19 9986221 missense probably benign
R4693:Best1 UTSW 19 9997135 missense probably damaging 1.00
R4851:Best1 UTSW 19 9991698 missense probably damaging 1.00
R4895:Best1 UTSW 19 9992771 missense probably benign 0.00
R5633:Best1 UTSW 19 9992103 missense probably benign 0.29
R5700:Best1 UTSW 19 9997199 unclassified probably benign
R5837:Best1 UTSW 19 9989119 splice site probably null
R6893:Best1 UTSW 19 9997082 missense probably damaging 1.00
R7021:Best1 UTSW 19 9986779 missense probably benign
R7220:Best1 UTSW 19 9992115 missense probably benign 0.31
R7267:Best1 UTSW 19 9986813 missense probably benign 0.00
R7284:Best1 UTSW 19 9986373 critical splice acceptor site probably null
R7489:Best1 UTSW 19 9997046 missense possibly damaging 0.68
R7568:Best1 UTSW 19 9989275 critical splice acceptor site probably null
R7798:Best1 UTSW 19 9991671 missense probably damaging 1.00
R8192:Best1 UTSW 19 9986300 missense possibly damaging 0.52
X0065:Best1 UTSW 19 9986975 missense probably benign 0.03
Z1177:Best1 UTSW 19 9993239 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACTGCTCTTCCCCAGATACAATG -3'
(R):5'- TGGGAACTGATGGGTCTGATCTCC -3'

Sequencing Primer
(F):5'- cctgtgtctcagtggcttc -3'
(R):5'- GGCCTGACTCTGGCTAATAAC -3'
Posted On2013-05-09