Incidental Mutation 'R0378:Srsf10'
Institutional Source Beutler Lab
Gene Symbol Srsf10
Ensembl Gene ENSMUSG00000028676
Gene Nameserine/arginine-rich splicing factor 10
SynonymsNssr, TASR2, Sfrs13a, FUSIP2, NSSR2, NSSR1, SRrp40, TASR1, Fusip1, Srsf13a
MMRRC Submission 038584-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0378 (G1)
Quality Score225
Status Validated
Chromosomal Location135855747-135869908 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135863190 bp
Amino Acid Change Tyrosine to Cysteine at position 142 (Y142C)
Ref Sequence ENSEMBL: ENSMUSP00000114564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097844] [ENSMUST00000102544] [ENSMUST00000105853] [ENSMUST00000126641]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000030438
Predicted Effect possibly damaging
Transcript: ENSMUST00000097844
AA Change: Y142C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095455
Gene: ENSMUSG00000028676
AA Change: Y142C

RRM 11 84 2.72e-25 SMART
low complexity region 105 157 N/A INTRINSIC
low complexity region 163 184 N/A INTRINSIC
low complexity region 217 259 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000102544
AA Change: Y142C
SMART Domains Protein: ENSMUSP00000099603
Gene: ENSMUSG00000028676
AA Change: Y142C

RRM 11 84 2.72e-25 SMART
low complexity region 105 157 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105853
AA Change: Y142C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101479
Gene: ENSMUSG00000028676
AA Change: Y142C

RRM 11 84 2.72e-25 SMART
low complexity region 105 160 N/A INTRINSIC
low complexity region 164 185 N/A INTRINSIC
low complexity region 218 260 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000126641
AA Change: Y142C

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114564
Gene: ENSMUSG00000028676
AA Change: Y142C

RRM 11 84 2.72e-25 SMART
low complexity region 105 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129718
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154447
Meta Mutation Damage Score 0.0789 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product is a member of the serine-arginine (SR) family of proteins, which are involved in constitutive and regulated RNA splicing. Members of this family are characterized by N-terminal RNP1 and RNP2 motifs, which are required for binding to RNA, and multiple C-terminal SR/RS repeats, which are important in mediating association with other cellular proteins. This protein interacts with the oncoprotein TLS, and abrogates the influence of TLS on adenovirus E1A pre-mRNA splicing. This gene has pseudogenes on chromosomes 4, 9, 14, 18, and 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit fetal and neonatal lethality associated with edema and cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 C A 8: 113,743,117 R651L probably damaging Het
Amd1 T C 10: 40,289,384 D317G possibly damaging Het
Artn A G 4: 117,927,618 probably benign Het
Asna1 A T 8: 85,025,264 M1K probably null Het
Bub1b T A 2: 118,641,123 V988E probably benign Het
Cyp2c65 G T 19: 39,073,218 C216F probably benign Het
Cyp3a11 T C 5: 145,868,607 E200G probably benign Het
Cyp3a25 T A 5: 145,986,842 K330N probably damaging Het
Duox2 C A 2: 122,284,583 V1138L probably benign Het
Erc2 A G 14: 28,011,694 D567G probably damaging Het
Eri2 A G 7: 119,793,916 probably null Het
Foxa3 A G 7: 19,023,369 Y17H probably damaging Het
Fto T C 8: 91,474,312 S324P probably damaging Het
Gls2 T G 10: 128,207,311 L457R probably benign Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Gtf3c1 G A 7: 125,647,614 R1508* probably null Het
Kif21a T C 15: 90,969,774 probably null Het
Klra5 A T 6: 129,906,614 D93E possibly damaging Het
Lgr5 T C 10: 115,454,499 D456G probably damaging Het
Mau2 A G 8: 70,030,655 S186P probably damaging Het
Msr1 T C 8: 39,589,382 D384G possibly damaging Het
Mum1 C A 10: 80,238,879 probably null Het
Ncf4 T C 15: 78,253,303 V93A probably damaging Het
Oas1f T G 5: 120,856,426 C337G probably damaging Het
Olfr119 A G 17: 37,701,041 M124V probably damaging Het
Olfr482 A T 7: 108,095,222 F116Y probably benign Het
Olfr820 T A 10: 130,018,003 L214H probably damaging Het
Rasl10b T C 11: 83,418,693 S159P probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Smg8 C A 11: 87,080,423 D841Y probably damaging Het
Sox7 T C 14: 63,943,949 V65A probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tcerg1l A G 7: 138,276,655 V326A probably benign Het
Tcl1b5 T A 12: 105,179,067 W97R probably damaging Het
Tmem108 T C 9: 103,499,657 R198G possibly damaging Het
Ube2ql1 T A 13: 69,738,898 Q148L possibly damaging Het
Vmn1r5 A T 6: 56,985,585 I82L probably benign Het
Wdr6 A T 9: 108,575,864 S273R probably damaging Het
Ylpm1 C T 12: 84,997,076 probably benign Het
Zfp90 G A 8: 106,425,506 R617Q possibly damaging Het
Other mutations in Srsf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0412:Srsf10 UTSW 4 135858403 missense probably damaging 1.00
R0540:Srsf10 UTSW 4 135863868 missense possibly damaging 0.66
R1733:Srsf10 UTSW 4 135863165 missense possibly damaging 0.53
R4957:Srsf10 UTSW 4 135856230 missense probably damaging 1.00
R5644:Srsf10 UTSW 4 135863820 missense possibly damaging 0.83
R5935:Srsf10 UTSW 4 135856242 missense probably damaging 0.98
R6645:Srsf10 UTSW 4 135863563 missense possibly damaging 0.83
R7229:Srsf10 UTSW 4 135856217 start gained probably benign
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- aaacgtcacccatacacataaatag -3'
Posted On2013-05-09