Incidental Mutation 'R0378:Klra5'
ID36464
Institutional Source Beutler Lab
Gene Symbol Klra5
Ensembl Gene ENSMUSG00000030173
Gene Namekiller cell lectin-like receptor, subfamily A, member 5
SynonymsLy49e
MMRRC Submission 038584-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0378 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location129898996-129917650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129906614 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 93 (D93E)
Ref Sequence ENSEMBL: ENSMUSP00000126290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014683] [ENSMUST00000118060] [ENSMUST00000169901]
Predicted Effect probably benign
Transcript: ENSMUST00000014683
AA Change: D183E

PolyPhen 2 Score 0.327 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000014683
Gene: ENSMUSG00000030173
AA Change: D183E

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Blast:CLECT 73 123 4e-9 BLAST
CLECT 143 258 3.66e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118060
AA Change: D183E

PolyPhen 2 Score 0.327 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000112795
Gene: ENSMUSG00000030173
AA Change: D183E

DomainStartEndE-ValueType
low complexity region 56 66 N/A INTRINSIC
Blast:CLECT 73 123 4e-9 BLAST
CLECT 143 258 3.66e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167079
SMART Domains Protein: ENSMUSP00000125971
Gene: ENSMUSG00000030173

DomainStartEndE-ValueType
CLECT 53 168 3.66e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000169901
AA Change: D93E

PolyPhen 2 Score 0.464 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126290
Gene: ENSMUSG00000030173
AA Change: D93E

DomainStartEndE-ValueType
CLECT 53 168 3.66e-18 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal NK and T cell morphology and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 C A 8: 113,743,117 R651L probably damaging Het
Amd1 T C 10: 40,289,384 D317G possibly damaging Het
Artn A G 4: 117,927,618 probably benign Het
Asna1 A T 8: 85,025,264 M1K probably null Het
Bub1b T A 2: 118,641,123 V988E probably benign Het
Cyp2c65 G T 19: 39,073,218 C216F probably benign Het
Cyp3a11 T C 5: 145,868,607 E200G probably benign Het
Cyp3a25 T A 5: 145,986,842 K330N probably damaging Het
Duox2 C A 2: 122,284,583 V1138L probably benign Het
Erc2 A G 14: 28,011,694 D567G probably damaging Het
Eri2 A G 7: 119,793,916 probably null Het
Foxa3 A G 7: 19,023,369 Y17H probably damaging Het
Fto T C 8: 91,474,312 S324P probably damaging Het
Gls2 T G 10: 128,207,311 L457R probably benign Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Gtf3c1 G A 7: 125,647,614 R1508* probably null Het
Kif21a T C 15: 90,969,774 probably null Het
Lgr5 T C 10: 115,454,499 D456G probably damaging Het
Mau2 A G 8: 70,030,655 S186P probably damaging Het
Msr1 T C 8: 39,589,382 D384G possibly damaging Het
Mum1 C A 10: 80,238,879 probably null Het
Ncf4 T C 15: 78,253,303 V93A probably damaging Het
Oas1f T G 5: 120,856,426 C337G probably damaging Het
Olfr119 A G 17: 37,701,041 M124V probably damaging Het
Olfr482 A T 7: 108,095,222 F116Y probably benign Het
Olfr820 T A 10: 130,018,003 L214H probably damaging Het
Rasl10b T C 11: 83,418,693 S159P probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Smg8 C A 11: 87,080,423 D841Y probably damaging Het
Sox7 T C 14: 63,943,949 V65A probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Srsf10 A G 4: 135,863,190 Y142C possibly damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tcerg1l A G 7: 138,276,655 V326A probably benign Het
Tcl1b5 T A 12: 105,179,067 W97R probably damaging Het
Tmem108 T C 9: 103,499,657 R198G possibly damaging Het
Ube2ql1 T A 13: 69,738,898 Q148L possibly damaging Het
Vmn1r5 A T 6: 56,985,585 I82L probably benign Het
Wdr6 A T 9: 108,575,864 S273R probably damaging Het
Ylpm1 C T 12: 84,997,076 probably benign Het
Zfp90 G A 8: 106,425,506 R617Q possibly damaging Het
Other mutations in Klra5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Klra5 APN 6 129911359 missense possibly damaging 0.63
IGL00972:Klra5 APN 6 129906605 missense probably damaging 1.00
IGL01770:Klra5 APN 6 129906664 missense probably damaging 1.00
IGL01978:Klra5 APN 6 129911430 missense probably benign 0.32
IGL01998:Klra5 APN 6 129906713 nonsense probably null
IGL02103:Klra5 APN 6 129911344 splice site probably null
IGL02995:Klra5 APN 6 129906614 missense possibly damaging 0.46
IGL03036:Klra5 APN 6 129908867 missense probably damaging 0.99
R0314:Klra5 UTSW 6 129903590 missense probably damaging 1.00
R0646:Klra5 UTSW 6 129903564 missense probably damaging 1.00
R0731:Klra5 UTSW 6 129908796 missense possibly damaging 0.88
R1552:Klra5 UTSW 6 129909885 missense probably damaging 0.97
R1572:Klra5 UTSW 6 129906622 missense probably damaging 1.00
R1807:Klra5 UTSW 6 129899420 missense probably benign 0.00
R4451:Klra5 UTSW 6 129908834 nonsense probably null
R4619:Klra5 UTSW 6 129908813 missense probably benign 0.05
R4647:Klra5 UTSW 6 129899376 missense probably damaging 0.99
R5019:Klra5 UTSW 6 129899389 missense probably benign
R5364:Klra5 UTSW 6 129899353 missense probably benign
R6724:Klra5 UTSW 6 129906680 missense probably benign 0.29
R6925:Klra5 UTSW 6 129911457 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ACAGACTTGTGTCCCACAGTTATGTTC -3'
(R):5'- GGCCTCAAACTGTTAGTGATCTTCCTG -3'

Sequencing Primer
(F):5'- CCCACAGTTATGTTCACATTACAGG -3'
(R):5'- tctctaatgattcatccatgattgac -3'
Posted On2013-05-09