Mutagenetix > Incidental Mutation

Incidental Mutation 'R0378:Olfr482'

36465

Institutional Source

Beutler Lab

Gene Symbol

Olfr482

Ensembl Gene

ENSMUSG00000059031

Gene Name

olfactory receptor 482

Synonyms

MOR204-14, GA_x6K02T2PBJ9-10424354-10423383

MMRRC Submission

038584-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R0378 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

108092999-108097586 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 108095222 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 116 (F116Y)

Ref Sequence

ENSEMBL: ENSMUSP00000150755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081184] [ENSMUST00000217304]

AlphaFold

Q8VG03

Predicted Effect

probably benign
Transcript: ENSMUST00000081184
AA Change: F116Y

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000079948
Gene: ENSMUSG00000059031
AA Change: F116Y

Domain	Start	End	E-Value	Type
Pfam:7tm_4	34	311	1.2e-52	PFAM
Pfam:7tm_1	44	293	8.1e-22	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000207291

Predicted Effect

probably benign
Transcript: ENSMUST00000217304
AA Change: F116Y

PolyPhen 2 Score 0.101 (Sensitivity: 0.93; Specificity: 0.86)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.0%
20x: 94.8%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts18	C	A	8: 113,743,117	R651L	probably damaging	Het
Amd1	T	C	10: 40,289,384	D317G	possibly damaging	Het
Artn	A	G	4: 117,927,618		probably benign	Het
Asna1	A	T	8: 85,025,264	M1K	probably null	Het
Bub1b	T	A	2: 118,641,123	V988E	probably benign	Het
Cyp2c65	G	T	19: 39,073,218	C216F	probably benign	Het
Cyp3a11	T	C	5: 145,868,607	E200G	probably benign	Het
Cyp3a25	T	A	5: 145,986,842	K330N	probably damaging	Het
Duox2	C	A	2: 122,284,583	V1138L	probably benign	Het
Erc2	A	G	14: 28,011,694	D567G	probably damaging	Het
Eri2	A	G	7: 119,793,916		probably null	Het
Foxa3	A	G	7: 19,023,369	Y17H	probably damaging	Het
Fto	T	C	8: 91,474,312	S324P	probably damaging	Het
Gls2	T	G	10: 128,207,311	L457R	probably benign	Het
Gstcd	A	T	3: 132,986,408	L582H	probably damaging	Het
Gtf3c1	G	A	7: 125,647,614	R1508*	probably null	Het
Kif21a	T	C	15: 90,969,774		probably null	Het
Klra5	A	T	6: 129,906,614	D93E	possibly damaging	Het
Lgr5	T	C	10: 115,454,499	D456G	probably damaging	Het
Mau2	A	G	8: 70,030,655	S186P	probably damaging	Het
Msr1	T	C	8: 39,589,382	D384G	possibly damaging	Het
Mum1	C	A	10: 80,238,879		probably null	Het
Ncf4	T	C	15: 78,253,303	V93A	probably damaging	Het
Oas1f	T	G	5: 120,856,426	C337G	probably damaging	Het
Olfr119	A	G	17: 37,701,041	M124V	probably damaging	Het
Olfr820	T	A	10: 130,018,003	L214H	probably damaging	Het
Rasl10b	T	C	11: 83,418,693	S159P	probably damaging	Het
Sephs1	A	G	2: 4,899,560	T250A	probably benign	Het
Smg8	C	A	11: 87,080,423	D841Y	probably damaging	Het
Sox7	T	C	14: 63,943,949	V65A	probably damaging	Het
Sp140	C	T	1: 85,620,051		probably benign	Het
Srsf10	A	G	4: 135,863,190	Y142C	possibly damaging	Het
Tcam1	G	A	11: 106,284,078	E120K	probably benign	Het
Tcerg1l	A	G	7: 138,276,655	V326A	probably benign	Het
Tcl1b5	T	A	12: 105,179,067	W97R	probably damaging	Het
Tmem108	T	C	9: 103,499,657	R198G	possibly damaging	Het
Ube2ql1	T	A	13: 69,738,898	Q148L	possibly damaging	Het
Vmn1r5	A	T	6: 56,985,585	I82L	probably benign	Het
Wdr6	A	T	9: 108,575,864	S273R	probably damaging	Het
Ylpm1	C	T	12: 84,997,076		probably benign	Het
Zfp90	G	A	8: 106,425,506	R617Q	possibly damaging	Het

Other mutations in Olfr482

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01400:Olfr482	APN	7	108094839	missense	probably damaging	1.00
IGL01482:Olfr482	APN	7	108095486	missense	probably benign	0.01
IGL01710:Olfr482	APN	7	108095242	missense	probably benign	0.00
IGL02064:Olfr482	APN	7	108095247	missense	probably benign	0.20
IGL02930:Olfr482	APN	7	108095414	missense	probably damaging	1.00
IGL03206:Olfr482	APN	7	108095054	missense	probably damaging	1.00
IGL03255:Olfr482	APN	7	108094817	missense	probably damaging	1.00
R0552:Olfr482	UTSW	7	108094778	missense	probably benign	0.01
R1538:Olfr482	UTSW	7	108095286	missense	probably damaging	1.00
R1771:Olfr482	UTSW	7	108095609	splice site	probably null
R1939:Olfr482	UTSW	7	108095141	missense	probably benign	0.06
R2258:Olfr482	UTSW	7	108095195	missense	possibly damaging	0.95
R4169:Olfr482	UTSW	7	108095384	missense	probably damaging	1.00
R4170:Olfr482	UTSW	7	108095073	missense	probably benign	0.00
R4485:Olfr482	UTSW	7	108095015	missense	probably benign
R4803:Olfr482	UTSW	7	108095459	missense	probably damaging	0.99
R4887:Olfr482	UTSW	7	108095096	missense	probably benign	0.18
R5059:Olfr482	UTSW	7	108095315	missense	probably damaging	1.00
R5445:Olfr482	UTSW	7	108094742	missense	possibly damaging	0.69
R5539:Olfr482	UTSW	7	108095226	missense	probably benign	0.23
R5644:Olfr482	UTSW	7	108094804	nonsense	probably null
R6200:Olfr482	UTSW	7	108095525	frame shift	probably null
R7171:Olfr482	UTSW	7	108095135	missense	probably benign	0.00
R8024:Olfr482	UTSW	7	108095289	missense	probably benign	0.19
R8316:Olfr482	UTSW	7	108095243	missense	probably benign	0.09
R9013:Olfr482	UTSW	7	108095264	missense	probably benign	0.02
R9376:Olfr482	UTSW	7	108095264	missense	possibly damaging	0.93
X0021:Olfr482	UTSW	7	108094959	missense	probably benign	0.20
Z1176:Olfr482	UTSW	7	108094994	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCGCATCTTCAGGACAGTGATGAG -3'
(R):5'- TACCTGGTGACTGTGTCTGGGAAC -3'

Sequencing Primer
(F):5'- ATTTTGTTTGGTCCACAGAAGAGC -3'
(R):5'- TGTCTGGGAACCTCAGCAC -3'

Posted On

2013-05-09