Incidental Mutation 'R0378:Msr1'
ID36469
Institutional Source Beutler Lab
Gene Symbol Msr1
Ensembl Gene ENSMUSG00000025044
Gene Namemacrophage scavenger receptor 1
SynonymsSR-AI, MSR-A, SR-AII, Scara1, Scvr, MRS-A
MMRRC Submission 038584-MU
Accession Numbers

Ncbi RefSeq: NM_001113326; MGI:98257

Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0378 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location39581685-39642673 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39589382 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 384 (D384G)
Ref Sequence ENSEMBL: ENSMUSP00000026021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026021]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026021
AA Change: D384G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026021
Gene: ENSMUSG00000025044
AA Change: D384G

DomainStartEndE-ValueType
transmembrane domain 58 80 N/A INTRINSIC
Pfam:Macscav_rec 125 173 1.5e-28 PFAM
coiled coil region 209 259 N/A INTRINSIC
Pfam:Collagen 275 330 3.2e-11 PFAM
Pfam:Collagen 295 353 4.8e-10 PFAM
SR 357 457 5.68e-56 SMART
Meta Mutation Damage Score 0.5849 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the class A macrophage scavenger receptors, which include three different types (1, 2, 3) generated by alternative splicing of this gene. These receptors or isoforms are macrophage-specific trimeric integral membrane glycoproteins and have been implicated in many macrophage-associated physiological and pathological processes including atherosclerosis, Alzheimer's disease, and host defense. The isoforms type 1 and type 2 are functional receptors and are able to mediate the endocytosis of modified low density lipoproteins (LDLs). The isoform type 3 does not internalize modified LDL (acetyl-LDL) despite having the domain shown to mediate this function in the types 1 and 2 isoforms. It has an altered intracellular processing and is trapped within the endoplasmic reticulum, making it unable to perform endocytosis. The isoform type 3 can inhibit the function of isoforms type 1 and type 2 when co-expressed, indicating a dominant negative effect and suggesting a mechanism for regulation of scavenger receptor activity in macrophages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal uptake and degradation of acetylated low density lipoproteins by macrophages, increased interleukin-12 secretion in response to CpG oligodeoxynucleotide administration, and increased bacterial and viral infection induced morbidity/mortality. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 C A 8: 113,743,117 R651L probably damaging Het
Amd1 T C 10: 40,289,384 D317G possibly damaging Het
Artn A G 4: 117,927,618 probably benign Het
Asna1 A T 8: 85,025,264 M1K probably null Het
Bub1b T A 2: 118,641,123 V988E probably benign Het
Cyp2c65 G T 19: 39,073,218 C216F probably benign Het
Cyp3a11 T C 5: 145,868,607 E200G probably benign Het
Cyp3a25 T A 5: 145,986,842 K330N probably damaging Het
Duox2 C A 2: 122,284,583 V1138L probably benign Het
Erc2 A G 14: 28,011,694 D567G probably damaging Het
Eri2 A G 7: 119,793,916 probably null Het
Foxa3 A G 7: 19,023,369 Y17H probably damaging Het
Fto T C 8: 91,474,312 S324P probably damaging Het
Gls2 T G 10: 128,207,311 L457R probably benign Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Gtf3c1 G A 7: 125,647,614 R1508* probably null Het
Kif21a T C 15: 90,969,774 probably null Het
Klra5 A T 6: 129,906,614 D93E possibly damaging Het
Lgr5 T C 10: 115,454,499 D456G probably damaging Het
Mau2 A G 8: 70,030,655 S186P probably damaging Het
Mum1 C A 10: 80,238,879 probably null Het
Ncf4 T C 15: 78,253,303 V93A probably damaging Het
Oas1f T G 5: 120,856,426 C337G probably damaging Het
Olfr119 A G 17: 37,701,041 M124V probably damaging Het
Olfr482 A T 7: 108,095,222 F116Y probably benign Het
Olfr820 T A 10: 130,018,003 L214H probably damaging Het
Rasl10b T C 11: 83,418,693 S159P probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Smg8 C A 11: 87,080,423 D841Y probably damaging Het
Sox7 T C 14: 63,943,949 V65A probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Srsf10 A G 4: 135,863,190 Y142C possibly damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tcerg1l A G 7: 138,276,655 V326A probably benign Het
Tcl1b5 T A 12: 105,179,067 W97R probably damaging Het
Tmem108 T C 9: 103,499,657 R198G possibly damaging Het
Ube2ql1 T A 13: 69,738,898 Q148L possibly damaging Het
Vmn1r5 A T 6: 56,985,585 I82L probably benign Het
Wdr6 A T 9: 108,575,864 S273R probably damaging Het
Ylpm1 C T 12: 84,997,076 probably benign Het
Zfp90 G A 8: 106,425,506 R617Q possibly damaging Het
Other mutations in Msr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01535:Msr1 APN 8 39611673 missense probably benign 0.42
IGL02047:Msr1 APN 8 39623960 missense probably benign 0.03
IGL02218:Msr1 APN 8 39589316 missense possibly damaging 0.51
IGL02347:Msr1 APN 8 39632737 missense probably damaging 1.00
IGL02546:Msr1 APN 8 39615747 missense probably benign
IGL02707:Msr1 APN 8 39632829 splice site probably benign
IGL03340:Msr1 APN 8 39620007 missense possibly damaging 0.53
R0349:Msr1 UTSW 8 39581827 missense probably damaging 1.00
R0633:Msr1 UTSW 8 39620000 missense probably damaging 0.99
R1386:Msr1 UTSW 8 39589293 nonsense probably null
R1807:Msr1 UTSW 8 39619907 missense probably benign 0.33
R2039:Msr1 UTSW 8 39589377 missense probably damaging 1.00
R2174:Msr1 UTSW 8 39631340 missense probably damaging 1.00
R2291:Msr1 UTSW 8 39624222 missense probably benign 0.03
R3983:Msr1 UTSW 8 39620018 missense possibly damaging 0.89
R4807:Msr1 UTSW 8 39642627 start gained probably benign
R4921:Msr1 UTSW 8 39624251 missense possibly damaging 0.72
R5055:Msr1 UTSW 8 39623956 missense possibly damaging 0.78
R5567:Msr1 UTSW 8 39611719 missense probably benign
R5570:Msr1 UTSW 8 39611719 missense probably benign
R5871:Msr1 UTSW 8 39611652 missense probably damaging 0.97
R5914:Msr1 UTSW 8 39581827 missense probably damaging 1.00
R6141:Msr1 UTSW 8 39631319 missense probably damaging 1.00
R6429:Msr1 UTSW 8 39615817 missense probably damaging 0.99
R6519:Msr1 UTSW 8 39624221 missense probably benign
R6527:Msr1 UTSW 8 39624233 missense possibly damaging 0.72
R6842:Msr1 UTSW 8 39632825 missense probably benign 0.01
R7006:Msr1 UTSW 8 39589382 missense probably damaging 0.99
R7047:Msr1 UTSW 8 39642616 missense possibly damaging 0.92
R7135:Msr1 UTSW 8 39589424 missense possibly damaging 0.93
R7552:Msr1 UTSW 8 39623962 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- GCACATGCAGTGCTCATGAAGTTCTC -3'
(R):5'- CTCTTGACCAGTAGGTGGCGAAAATAG -3'

Sequencing Primer
(F):5'- CAGTGCTCATGAAGTTCTCAAAAC -3'
(R):5'- gagaagaggaggggaaggg -3'
Posted On2013-05-09