Incidental Mutation 'R0378:Msr1'
ID 36469
Institutional Source Beutler Lab
Gene Symbol Msr1
Ensembl Gene ENSMUSG00000025044
Gene Name macrophage scavenger receptor 1
Synonyms SR-AII, Scara1, MRS-A, Scvr, MSR-A, SR-AI
MMRRC Submission 038584-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.060) question?
Stock # R0378 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 40034726-40095714 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 40042423 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 384 (D384G)
Ref Sequence ENSEMBL: ENSMUSP00000026021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026021]
AlphaFold P30204
Predicted Effect possibly damaging
Transcript: ENSMUST00000026021
AA Change: D384G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026021
Gene: ENSMUSG00000025044
AA Change: D384G

DomainStartEndE-ValueType
transmembrane domain 58 80 N/A INTRINSIC
Pfam:Macscav_rec 125 173 1.5e-28 PFAM
coiled coil region 209 259 N/A INTRINSIC
Pfam:Collagen 275 330 3.2e-11 PFAM
Pfam:Collagen 295 353 4.8e-10 PFAM
SR 357 457 5.68e-56 SMART
Meta Mutation Damage Score 0.5849 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the class A macrophage scavenger receptors, which include three different types (1, 2, 3) generated by alternative splicing of this gene. These receptors or isoforms are macrophage-specific trimeric integral membrane glycoproteins and have been implicated in many macrophage-associated physiological and pathological processes including atherosclerosis, Alzheimer's disease, and host defense. The isoforms type 1 and type 2 are functional receptors and are able to mediate the endocytosis of modified low density lipoproteins (LDLs). The isoform type 3 does not internalize modified LDL (acetyl-LDL) despite having the domain shown to mediate this function in the types 1 and 2 isoforms. It has an altered intracellular processing and is trapped within the endoplasmic reticulum, making it unable to perform endocytosis. The isoform type 3 can inhibit the function of isoforms type 1 and type 2 when co-expressed, indicating a dominant negative effect and suggesting a mechanism for regulation of scavenger receptor activity in macrophages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal uptake and degradation of acetylated low density lipoproteins by macrophages, increased interleukin-12 secretion in response to CpG oligodeoxynucleotide administration, and increased bacterial and viral infection induced morbidity/mortality. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 C A 8: 114,469,749 (GRCm39) R651L probably damaging Het
Amd1 T C 10: 40,165,380 (GRCm39) D317G possibly damaging Het
Artn A G 4: 117,784,815 (GRCm39) probably benign Het
Bub1b T A 2: 118,471,604 (GRCm39) V988E probably benign Het
Cyp2c65 G T 19: 39,061,662 (GRCm39) C216F probably benign Het
Cyp3a11 T C 5: 145,805,417 (GRCm39) E200G probably benign Het
Cyp3a25 T A 5: 145,923,652 (GRCm39) K330N probably damaging Het
Duox2 C A 2: 122,115,064 (GRCm39) V1138L probably benign Het
Erc2 A G 14: 27,733,651 (GRCm39) D567G probably damaging Het
Eri2 A G 7: 119,393,139 (GRCm39) probably null Het
Foxa3 A G 7: 18,757,294 (GRCm39) Y17H probably damaging Het
Fto T C 8: 92,200,940 (GRCm39) S324P probably damaging Het
Get3 A T 8: 85,751,893 (GRCm39) M1K probably null Het
Gls2 T G 10: 128,043,180 (GRCm39) L457R probably benign Het
Gstcd A T 3: 132,692,169 (GRCm39) L582H probably damaging Het
Gtf3c1 G A 7: 125,246,786 (GRCm39) R1508* probably null Het
Kif21a T C 15: 90,853,977 (GRCm39) probably null Het
Klra5 A T 6: 129,883,577 (GRCm39) D93E possibly damaging Het
Lgr5 T C 10: 115,290,404 (GRCm39) D456G probably damaging Het
Mau2 A G 8: 70,483,305 (GRCm39) S186P probably damaging Het
Ncf4 T C 15: 78,137,503 (GRCm39) V93A probably damaging Het
Oas1f T G 5: 120,994,489 (GRCm39) C337G probably damaging Het
Or10al3 A G 17: 38,011,932 (GRCm39) M124V probably damaging Het
Or5p58 A T 7: 107,694,429 (GRCm39) F116Y probably benign Het
Or6c33 T A 10: 129,853,872 (GRCm39) L214H probably damaging Het
Pwwp3a C A 10: 80,074,713 (GRCm39) probably null Het
Rasl10b T C 11: 83,309,519 (GRCm39) S159P probably damaging Het
Sephs1 A G 2: 4,904,371 (GRCm39) T250A probably benign Het
Smg8 C A 11: 86,971,249 (GRCm39) D841Y probably damaging Het
Sox7 T C 14: 64,181,398 (GRCm39) V65A probably damaging Het
Sp140 C T 1: 85,547,772 (GRCm39) probably benign Het
Srsf10 A G 4: 135,590,501 (GRCm39) Y142C possibly damaging Het
Tcam1 G A 11: 106,174,904 (GRCm39) E120K probably benign Het
Tcerg1l A G 7: 137,878,384 (GRCm39) V326A probably benign Het
Tcl1b5 T A 12: 105,145,326 (GRCm39) W97R probably damaging Het
Tmem108 T C 9: 103,376,856 (GRCm39) R198G possibly damaging Het
Ube2ql1 T A 13: 69,887,017 (GRCm39) Q148L possibly damaging Het
Vmn1r5 A T 6: 56,962,570 (GRCm39) I82L probably benign Het
Wdr6 A T 9: 108,453,063 (GRCm39) S273R probably damaging Het
Ylpm1 C T 12: 85,043,850 (GRCm39) probably benign Het
Zfp90 G A 8: 107,152,138 (GRCm39) R617Q possibly damaging Het
Other mutations in Msr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01535:Msr1 APN 8 40,064,714 (GRCm39) missense probably benign 0.42
IGL02047:Msr1 APN 8 40,077,001 (GRCm39) missense probably benign 0.03
IGL02218:Msr1 APN 8 40,042,357 (GRCm39) missense possibly damaging 0.51
IGL02347:Msr1 APN 8 40,085,778 (GRCm39) missense probably damaging 1.00
IGL02546:Msr1 APN 8 40,068,788 (GRCm39) missense probably benign
IGL02707:Msr1 APN 8 40,085,870 (GRCm39) splice site probably benign
IGL03340:Msr1 APN 8 40,073,048 (GRCm39) missense possibly damaging 0.53
R0349:Msr1 UTSW 8 40,034,868 (GRCm39) missense probably damaging 1.00
R0633:Msr1 UTSW 8 40,073,041 (GRCm39) missense probably damaging 0.99
R1386:Msr1 UTSW 8 40,042,334 (GRCm39) nonsense probably null
R1807:Msr1 UTSW 8 40,072,948 (GRCm39) missense probably benign 0.33
R2039:Msr1 UTSW 8 40,042,418 (GRCm39) missense probably damaging 1.00
R2174:Msr1 UTSW 8 40,084,381 (GRCm39) missense probably damaging 1.00
R2291:Msr1 UTSW 8 40,077,263 (GRCm39) missense probably benign 0.03
R3983:Msr1 UTSW 8 40,073,059 (GRCm39) missense possibly damaging 0.89
R4807:Msr1 UTSW 8 40,095,668 (GRCm39) start gained probably benign
R4921:Msr1 UTSW 8 40,077,292 (GRCm39) missense possibly damaging 0.72
R5055:Msr1 UTSW 8 40,076,997 (GRCm39) missense possibly damaging 0.78
R5567:Msr1 UTSW 8 40,064,760 (GRCm39) missense probably benign
R5570:Msr1 UTSW 8 40,064,760 (GRCm39) missense probably benign
R5871:Msr1 UTSW 8 40,064,693 (GRCm39) missense probably damaging 0.97
R5914:Msr1 UTSW 8 40,034,868 (GRCm39) missense probably damaging 1.00
R6141:Msr1 UTSW 8 40,084,360 (GRCm39) missense probably damaging 1.00
R6429:Msr1 UTSW 8 40,068,858 (GRCm39) missense probably damaging 0.99
R6519:Msr1 UTSW 8 40,077,262 (GRCm39) missense probably benign
R6527:Msr1 UTSW 8 40,077,274 (GRCm39) missense possibly damaging 0.72
R6842:Msr1 UTSW 8 40,085,866 (GRCm39) missense probably benign 0.01
R7006:Msr1 UTSW 8 40,042,423 (GRCm39) missense probably damaging 0.99
R7047:Msr1 UTSW 8 40,095,657 (GRCm39) missense possibly damaging 0.92
R7135:Msr1 UTSW 8 40,042,465 (GRCm39) missense possibly damaging 0.93
R7552:Msr1 UTSW 8 40,077,003 (GRCm39) missense probably benign 0.19
R7837:Msr1 UTSW 8 40,034,873 (GRCm39) missense probably damaging 0.99
R8995:Msr1 UTSW 8 40,042,460 (GRCm39) missense possibly damaging 0.54
R9707:Msr1 UTSW 8 40,076,988 (GRCm39) missense probably benign 0.06
R9723:Msr1 UTSW 8 40,042,357 (GRCm39) missense possibly damaging 0.51
Z1177:Msr1 UTSW 8 40,084,343 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACATGCAGTGCTCATGAAGTTCTC -3'
(R):5'- CTCTTGACCAGTAGGTGGCGAAAATAG -3'

Sequencing Primer
(F):5'- CAGTGCTCATGAAGTTCTCAAAAC -3'
(R):5'- gagaagaggaggggaaggg -3'
Posted On 2013-05-09