Incidental Mutation 'R0378:Zfp90'
Institutional Source Beutler Lab
Gene Symbol Zfp90
Ensembl Gene ENSMUSG00000031907
Gene Namezinc finger protein 90
SynonymsKRAB17, Zfp83, NK10, Nk10 expressed protein, 6430515L01Rik, Zfp64
MMRRC Submission 038584-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R0378 (G1)
Quality Score225
Status Validated
Chromosomal Location106415327-106426598 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106425506 bp
Amino Acid Change Arginine to Glutamine at position 617 (R617Q)
Ref Sequence ENSEMBL: ENSMUSP00000148744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034382] [ENSMUST00000212606] [ENSMUST00000212874] [ENSMUST00000213045]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034382
AA Change: R617Q

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034382
Gene: ENSMUSG00000031907
AA Change: R617Q

KRAB 14 74 4.83e-40 SMART
ZnF_C2H2 208 230 1.38e-3 SMART
ZnF_C2H2 250 272 2.75e-3 SMART
ZnF_C2H2 278 300 3.83e-2 SMART
ZnF_C2H2 306 328 1.13e-4 SMART
ZnF_C2H2 334 356 2.09e-3 SMART
ZnF_C2H2 362 384 3.16e-3 SMART
ZnF_C2H2 390 412 1.6e-4 SMART
ZnF_C2H2 446 468 1.92e-2 SMART
ZnF_C2H2 494 516 3.69e-4 SMART
ZnF_C2H2 522 544 5.59e-4 SMART
ZnF_C2H2 550 572 1.28e-3 SMART
ZnF_C2H2 578 600 1.28e-3 SMART
ZnF_C2H2 606 628 2.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211958
Predicted Effect probably benign
Transcript: ENSMUST00000212606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212866
Predicted Effect possibly damaging
Transcript: ENSMUST00000212874
AA Change: R617Q

PolyPhen 2 Score 0.686 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000213045
Meta Mutation Damage Score 0.0818 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc finger protein family that modulates gene expression. The encoded protein derepresses the transcription of certain fetal cardiac genes and may contribute to the genetic reprogramming that occurs during the development of heart failure. Genome wide association studies have identified this gene among ulcerative colitis risk loci. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 C A 8: 113,743,117 R651L probably damaging Het
Amd1 T C 10: 40,289,384 D317G possibly damaging Het
Artn A G 4: 117,927,618 probably benign Het
Asna1 A T 8: 85,025,264 M1K probably null Het
Bub1b T A 2: 118,641,123 V988E probably benign Het
Cyp2c65 G T 19: 39,073,218 C216F probably benign Het
Cyp3a11 T C 5: 145,868,607 E200G probably benign Het
Cyp3a25 T A 5: 145,986,842 K330N probably damaging Het
Duox2 C A 2: 122,284,583 V1138L probably benign Het
Erc2 A G 14: 28,011,694 D567G probably damaging Het
Eri2 A G 7: 119,793,916 probably null Het
Foxa3 A G 7: 19,023,369 Y17H probably damaging Het
Fto T C 8: 91,474,312 S324P probably damaging Het
Gls2 T G 10: 128,207,311 L457R probably benign Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Gtf3c1 G A 7: 125,647,614 R1508* probably null Het
Kif21a T C 15: 90,969,774 probably null Het
Klra5 A T 6: 129,906,614 D93E possibly damaging Het
Lgr5 T C 10: 115,454,499 D456G probably damaging Het
Mau2 A G 8: 70,030,655 S186P probably damaging Het
Msr1 T C 8: 39,589,382 D384G possibly damaging Het
Mum1 C A 10: 80,238,879 probably null Het
Ncf4 T C 15: 78,253,303 V93A probably damaging Het
Oas1f T G 5: 120,856,426 C337G probably damaging Het
Olfr119 A G 17: 37,701,041 M124V probably damaging Het
Olfr482 A T 7: 108,095,222 F116Y probably benign Het
Olfr820 T A 10: 130,018,003 L214H probably damaging Het
Rasl10b T C 11: 83,418,693 S159P probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Smg8 C A 11: 87,080,423 D841Y probably damaging Het
Sox7 T C 14: 63,943,949 V65A probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Srsf10 A G 4: 135,863,190 Y142C possibly damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tcerg1l A G 7: 138,276,655 V326A probably benign Het
Tcl1b5 T A 12: 105,179,067 W97R probably damaging Het
Tmem108 T C 9: 103,499,657 R198G possibly damaging Het
Ube2ql1 T A 13: 69,738,898 Q148L possibly damaging Het
Vmn1r5 A T 6: 56,985,585 I82L probably benign Het
Wdr6 A T 9: 108,575,864 S273R probably damaging Het
Ylpm1 C T 12: 84,997,076 probably benign Het
Other mutations in Zfp90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Zfp90 APN 8 106424150 missense probably benign 0.00
IGL02170:Zfp90 APN 8 106419524 missense probably damaging 0.99
IGL02818:Zfp90 APN 8 106424209 missense probably benign
R0462:Zfp90 UTSW 8 106425260 missense possibly damaging 0.89
R1555:Zfp90 UTSW 8 106424095 missense probably benign
R1869:Zfp90 UTSW 8 106419123 missense probably benign 0.00
R1870:Zfp90 UTSW 8 106419123 missense probably benign 0.00
R2110:Zfp90 UTSW 8 106425488 missense probably damaging 1.00
R2112:Zfp90 UTSW 8 106425488 missense probably damaging 1.00
R3717:Zfp90 UTSW 8 106424050 missense probably benign 0.12
R4506:Zfp90 UTSW 8 106424864 missense possibly damaging 0.78
R5288:Zfp90 UTSW 8 106425368 missense probably damaging 1.00
R5691:Zfp90 UTSW 8 106425078 nonsense probably null
R5789:Zfp90 UTSW 8 106423973 missense probably benign
R6283:Zfp90 UTSW 8 106425394 missense probably damaging 1.00
R6560:Zfp90 UTSW 8 106415747 missense probably damaging 0.99
R6977:Zfp90 UTSW 8 106425316 missense probably damaging 1.00
R6977:Zfp90 UTSW 8 106425317 missense probably damaging 0.99
R7040:Zfp90 UTSW 8 106425009 nonsense probably null
R7196:Zfp90 UTSW 8 106425148 missense probably damaging 0.99
R7523:Zfp90 UTSW 8 106423913 missense probably benign 0.07
R7535:Zfp90 UTSW 8 106424268 missense possibly damaging 0.94
R7546:Zfp90 UTSW 8 106424691 missense probably benign 0.22
R7719:Zfp90 UTSW 8 106419093 missense probably damaging 1.00
R8036:Zfp90 UTSW 8 106419128 missense probably benign 0.21
R8056:Zfp90 UTSW 8 106424480 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tgaatgtaatgagtgtggggaag -3'
Posted On2013-05-09