Mutagenetix > Incidental Mutation

Incidental Mutation 'R0378:Adamts18'

36474

Institutional Source

Beutler Lab

Gene Symbol

Adamts18

Ensembl Gene

ENSMUSG00000053399

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 18

Synonyms

E130314N14Rik

MMRRC Submission

038584-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.137) question?

Stock #

R0378 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

113697126-113848738 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 113743117 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 651 (R651L)

Ref Sequence

ENSEMBL: ENSMUSP00000090801 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093113] [ENSMUST00000212665]

AlphaFold

Q4VC17

Predicted Effect

probably damaging
Transcript: ENSMUST00000093113
AA Change: R651L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000090801
Gene: ENSMUSG00000053399
AA Change: R651L

Domain	Start	End	E-Value	Type
signal peptide	1	47	N/A	INTRINSIC
Pfam:Pep_M12B_propep	63	203	3.4e-37	PFAM
Pfam:Reprolysin_5	292	473	1.3e-14	PFAM
Pfam:Reprolysin_4	294	494	2.6e-11	PFAM
Pfam:Reprolysin	294	498	2.7e-30	PFAM
Pfam:Reprolysin_2	311	488	1.7e-14	PFAM
Pfam:Reprolysin_3	315	447	1.5e-11	PFAM
TSP1	592	644	7.37e-17	SMART
Pfam:ADAM_spacer1	749	861	1.7e-38	PFAM
TSP1	878	932	1.55e-1	SMART
TSP1	934	992	5.07e-6	SMART
TSP1	994	1049	1.65e-5	SMART
TSP1	1055	1116	1.71e-3	SMART
TSP1	1125	1171	5.27e-4	SMART
Pfam:PLAC	1186	1216	1.2e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000212437

Predicted Effect

probably benign
Transcript: ENSMUST00000212665

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000213076

Meta Mutation Damage Score

0.8068

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.0%
20x: 94.8%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may regulate hemostatic balance and function as a tumor suppressor. Mutations in this gene may be associated with microcornea, myopic chorioretinal atrophy, and telecanthus (MMCAT) and cone-rod dystrophy in human patients. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a floxed allele exhibit some fertility defects. Mice homozygous for a null allele exhibit growth and eye defects and increased susceptibility to chemically induced tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Amd1	T	C	10: 40,289,384	D317G	possibly damaging	Het
Artn	A	G	4: 117,927,618		probably benign	Het
Asna1	A	T	8: 85,025,264	M1K	probably null	Het
Bub1b	T	A	2: 118,641,123	V988E	probably benign	Het
Cyp2c65	G	T	19: 39,073,218	C216F	probably benign	Het
Cyp3a11	T	C	5: 145,868,607	E200G	probably benign	Het
Cyp3a25	T	A	5: 145,986,842	K330N	probably damaging	Het
Duox2	C	A	2: 122,284,583	V1138L	probably benign	Het
Erc2	A	G	14: 28,011,694	D567G	probably damaging	Het
Eri2	A	G	7: 119,793,916		probably null	Het
Foxa3	A	G	7: 19,023,369	Y17H	probably damaging	Het
Fto	T	C	8: 91,474,312	S324P	probably damaging	Het
Gls2	T	G	10: 128,207,311	L457R	probably benign	Het
Gstcd	A	T	3: 132,986,408	L582H	probably damaging	Het
Gtf3c1	G	A	7: 125,647,614	R1508*	probably null	Het
Kif21a	T	C	15: 90,969,774		probably null	Het
Klra5	A	T	6: 129,906,614	D93E	possibly damaging	Het
Lgr5	T	C	10: 115,454,499	D456G	probably damaging	Het
Mau2	A	G	8: 70,030,655	S186P	probably damaging	Het
Msr1	T	C	8: 39,589,382	D384G	possibly damaging	Het
Mum1	C	A	10: 80,238,879		probably null	Het
Ncf4	T	C	15: 78,253,303	V93A	probably damaging	Het
Oas1f	T	G	5: 120,856,426	C337G	probably damaging	Het
Olfr119	A	G	17: 37,701,041	M124V	probably damaging	Het
Olfr482	A	T	7: 108,095,222	F116Y	probably benign	Het
Olfr820	T	A	10: 130,018,003	L214H	probably damaging	Het
Rasl10b	T	C	11: 83,418,693	S159P	probably damaging	Het
Sephs1	A	G	2: 4,899,560	T250A	probably benign	Het
Smg8	C	A	11: 87,080,423	D841Y	probably damaging	Het
Sox7	T	C	14: 63,943,949	V65A	probably damaging	Het
Sp140	C	T	1: 85,620,051		probably benign	Het
Srsf10	A	G	4: 135,863,190	Y142C	possibly damaging	Het
Tcam1	G	A	11: 106,284,078	E120K	probably benign	Het
Tcerg1l	A	G	7: 138,276,655	V326A	probably benign	Het
Tcl1b5	T	A	12: 105,179,067	W97R	probably damaging	Het
Tmem108	T	C	9: 103,499,657	R198G	possibly damaging	Het
Ube2ql1	T	A	13: 69,738,898	Q148L	possibly damaging	Het
Vmn1r5	A	T	6: 56,985,585	I82L	probably benign	Het
Wdr6	A	T	9: 108,575,864	S273R	probably damaging	Het
Ylpm1	C	T	12: 84,997,076		probably benign	Het
Zfp90	G	A	8: 106,425,506	R617Q	possibly damaging	Het

Other mutations in Adamts18

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01290:Adamts18	APN	8	113774943	missense	probably damaging	1.00
IGL01548:Adamts18	APN	8	113764299	missense	probably damaging	1.00
IGL01556:Adamts18	APN	8	113845109	missense	probably benign	0.01
IGL01833:Adamts18	APN	8	113743096	missense	probably benign	0.10
IGL02187:Adamts18	APN	8	113713194	missense	possibly damaging	0.93
IGL02551:Adamts18	APN	8	113699072	missense	probably damaging	1.00
IGL02756:Adamts18	APN	8	113714344	splice site	probably benign
IGL03188:Adamts18	APN	8	113699024	missense	probably damaging	1.00
IGL03411:Adamts18	APN	8	113764297	nonsense	probably null
G1patch:Adamts18	UTSW	8	113743201	missense	probably damaging	1.00
R0119:Adamts18	UTSW	8	113774953	missense	possibly damaging	0.94
R0410:Adamts18	UTSW	8	113714358	nonsense	probably null
R0480:Adamts18	UTSW	8	113738818	missense	possibly damaging	0.93
R0514:Adamts18	UTSW	8	113738769	splice site	probably null
R0924:Adamts18	UTSW	8	113705396	splice site	probably null
R0930:Adamts18	UTSW	8	113705396	splice site	probably null
R1333:Adamts18	UTSW	8	113705173	splice site	probably benign
R1441:Adamts18	UTSW	8	113754562	critical splice donor site	probably null
R2082:Adamts18	UTSW	8	113775333	missense	probably damaging	1.00
R2146:Adamts18	UTSW	8	113845003	missense	possibly damaging	0.58
R2371:Adamts18	UTSW	8	113705261	missense	probably benign	0.36
R3148:Adamts18	UTSW	8	113738858	missense	probably damaging	1.00
R3963:Adamts18	UTSW	8	113777811	missense	probably benign	0.00
R4056:Adamts18	UTSW	8	113737580	nonsense	probably null
R4486:Adamts18	UTSW	8	113713193	missense	probably benign	0.00
R4608:Adamts18	UTSW	8	113737613	missense	probably damaging	1.00
R4624:Adamts18	UTSW	8	113773168	nonsense	probably null
R4626:Adamts18	UTSW	8	113773168	nonsense	probably null
R4627:Adamts18	UTSW	8	113773168	nonsense	probably null
R4628:Adamts18	UTSW	8	113773168	nonsense	probably null
R4629:Adamts18	UTSW	8	113773168	nonsense	probably null
R4710:Adamts18	UTSW	8	113706926	missense	probably damaging	0.98
R4959:Adamts18	UTSW	8	113736725	nonsense	probably null
R4973:Adamts18	UTSW	8	113736725	nonsense	probably null
R4976:Adamts18	UTSW	8	113699010	missense	probably benign	0.31
R5119:Adamts18	UTSW	8	113699010	missense	probably benign	0.31
R5141:Adamts18	UTSW	8	113775270	missense	probably damaging	1.00
R5422:Adamts18	UTSW	8	113698974	missense	probably benign	0.06
R5587:Adamts18	UTSW	8	113775360	nonsense	probably null
R5868:Adamts18	UTSW	8	113777748	missense	possibly damaging	0.69
R5893:Adamts18	UTSW	8	113773077	missense	probably damaging	1.00
R5906:Adamts18	UTSW	8	113709619	missense	probably benign	0.00
R5942:Adamts18	UTSW	8	113777748	missense	probably benign	0.01
R6006:Adamts18	UTSW	8	113706974	missense	probably damaging	1.00
R6608:Adamts18	UTSW	8	113775279	missense	probably damaging	1.00
R6725:Adamts18	UTSW	8	113743201	missense	probably damaging	1.00
R7002:Adamts18	UTSW	8	113775290	missense	possibly damaging	0.69
R7276:Adamts18	UTSW	8	113775264	missense	probably damaging	0.99
R7292:Adamts18	UTSW	8	113709645	missense	probably benign	0.00
R7411:Adamts18	UTSW	8	113777730	missense	probably damaging	0.99
R7685:Adamts18	UTSW	8	113713223	missense	probably damaging	1.00
R7737:Adamts18	UTSW	8	113736934	splice site	probably null
R7860:Adamts18	UTSW	8	113775276	missense	probably damaging	1.00
R7936:Adamts18	UTSW	8	113767128	missense	probably damaging	1.00
R8197:Adamts18	UTSW	8	113754595	missense	probably damaging	1.00
R8363:Adamts18	UTSW	8	113767163	missense	probably damaging	1.00
R8759:Adamts18	UTSW	8	113706992	missense	probably damaging	1.00
R8934:Adamts18	UTSW	8	113736878	missense	possibly damaging	0.90
R9405:Adamts18	UTSW	8	113703398	missense	probably damaging	1.00
R9422:Adamts18	UTSW	8	113775278	missense	probably damaging	1.00
R9450:Adamts18	UTSW	8	113764310	missense	probably benign	0.10
R9475:Adamts18	UTSW	8	113777938	missense	possibly damaging	0.93
Z1088:Adamts18	UTSW	8	113775440	missense	possibly damaging	0.86
Z1176:Adamts18	UTSW	8	113743168	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- TCAACGGTACATTTAAGGCCGGG -3'
(R):5'- ACTGTGACCACAGAGTCTCTGACAC -3'

Sequencing Primer
(F):5'- ggggggggggAAGACTG -3'
(R):5'- AGGCCATATTAAGTCCCTGTG -3'

Posted On

2013-05-09