Incidental Mutation 'R0378:Adamts18'
ID 36474
Institutional Source Beutler Lab
Gene Symbol Adamts18
Ensembl Gene ENSMUSG00000053399
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 18
Synonyms E130314N14Rik
MMRRC Submission 038584-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.127) question?
Stock # R0378 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 114423758-114575370 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 114469749 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 651 (R651L)
Ref Sequence ENSEMBL: ENSMUSP00000090801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093113] [ENSMUST00000212665]
AlphaFold Q4VC17
Predicted Effect probably damaging
Transcript: ENSMUST00000093113
AA Change: R651L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090801
Gene: ENSMUSG00000053399
AA Change: R651L

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
Pfam:Pep_M12B_propep 63 203 3.4e-37 PFAM
Pfam:Reprolysin_5 292 473 1.3e-14 PFAM
Pfam:Reprolysin_4 294 494 2.6e-11 PFAM
Pfam:Reprolysin 294 498 2.7e-30 PFAM
Pfam:Reprolysin_2 311 488 1.7e-14 PFAM
Pfam:Reprolysin_3 315 447 1.5e-11 PFAM
TSP1 592 644 7.37e-17 SMART
Pfam:ADAM_spacer1 749 861 1.7e-38 PFAM
TSP1 878 932 1.55e-1 SMART
TSP1 934 992 5.07e-6 SMART
TSP1 994 1049 1.65e-5 SMART
TSP1 1055 1116 1.71e-3 SMART
TSP1 1125 1171 5.27e-4 SMART
Pfam:PLAC 1186 1216 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000212437
Predicted Effect probably benign
Transcript: ENSMUST00000212665
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213076
Meta Mutation Damage Score 0.8068 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. ADAMTS family members share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protein, which may regulate hemostatic balance and function as a tumor suppressor. Mutations in this gene may be associated with microcornea, myopic chorioretinal atrophy, and telecanthus (MMCAT) and cone-rod dystrophy in human patients. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for a floxed allele exhibit some fertility defects. Mice homozygous for a null allele exhibit growth and eye defects and increased susceptibility to chemically induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Amd1 T C 10: 40,165,380 (GRCm39) D317G possibly damaging Het
Artn A G 4: 117,784,815 (GRCm39) probably benign Het
Bub1b T A 2: 118,471,604 (GRCm39) V988E probably benign Het
Cyp2c65 G T 19: 39,061,662 (GRCm39) C216F probably benign Het
Cyp3a11 T C 5: 145,805,417 (GRCm39) E200G probably benign Het
Cyp3a25 T A 5: 145,923,652 (GRCm39) K330N probably damaging Het
Duox2 C A 2: 122,115,064 (GRCm39) V1138L probably benign Het
Erc2 A G 14: 27,733,651 (GRCm39) D567G probably damaging Het
Eri2 A G 7: 119,393,139 (GRCm39) probably null Het
Foxa3 A G 7: 18,757,294 (GRCm39) Y17H probably damaging Het
Fto T C 8: 92,200,940 (GRCm39) S324P probably damaging Het
Get3 A T 8: 85,751,893 (GRCm39) M1K probably null Het
Gls2 T G 10: 128,043,180 (GRCm39) L457R probably benign Het
Gstcd A T 3: 132,692,169 (GRCm39) L582H probably damaging Het
Gtf3c1 G A 7: 125,246,786 (GRCm39) R1508* probably null Het
Kif21a T C 15: 90,853,977 (GRCm39) probably null Het
Klra5 A T 6: 129,883,577 (GRCm39) D93E possibly damaging Het
Lgr5 T C 10: 115,290,404 (GRCm39) D456G probably damaging Het
Mau2 A G 8: 70,483,305 (GRCm39) S186P probably damaging Het
Msr1 T C 8: 40,042,423 (GRCm39) D384G possibly damaging Het
Ncf4 T C 15: 78,137,503 (GRCm39) V93A probably damaging Het
Oas1f T G 5: 120,994,489 (GRCm39) C337G probably damaging Het
Or10al3 A G 17: 38,011,932 (GRCm39) M124V probably damaging Het
Or5p58 A T 7: 107,694,429 (GRCm39) F116Y probably benign Het
Or6c33 T A 10: 129,853,872 (GRCm39) L214H probably damaging Het
Pwwp3a C A 10: 80,074,713 (GRCm39) probably null Het
Rasl10b T C 11: 83,309,519 (GRCm39) S159P probably damaging Het
Sephs1 A G 2: 4,904,371 (GRCm39) T250A probably benign Het
Smg8 C A 11: 86,971,249 (GRCm39) D841Y probably damaging Het
Sox7 T C 14: 64,181,398 (GRCm39) V65A probably damaging Het
Sp140 C T 1: 85,547,772 (GRCm39) probably benign Het
Srsf10 A G 4: 135,590,501 (GRCm39) Y142C possibly damaging Het
Tcam1 G A 11: 106,174,904 (GRCm39) E120K probably benign Het
Tcerg1l A G 7: 137,878,384 (GRCm39) V326A probably benign Het
Tcl1b5 T A 12: 105,145,326 (GRCm39) W97R probably damaging Het
Tmem108 T C 9: 103,376,856 (GRCm39) R198G possibly damaging Het
Ube2ql1 T A 13: 69,887,017 (GRCm39) Q148L possibly damaging Het
Vmn1r5 A T 6: 56,962,570 (GRCm39) I82L probably benign Het
Wdr6 A T 9: 108,453,063 (GRCm39) S273R probably damaging Het
Ylpm1 C T 12: 85,043,850 (GRCm39) probably benign Het
Zfp90 G A 8: 107,152,138 (GRCm39) R617Q possibly damaging Het
Other mutations in Adamts18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01290:Adamts18 APN 8 114,501,575 (GRCm39) missense probably damaging 1.00
IGL01548:Adamts18 APN 8 114,490,931 (GRCm39) missense probably damaging 1.00
IGL01556:Adamts18 APN 8 114,571,741 (GRCm39) missense probably benign 0.01
IGL01833:Adamts18 APN 8 114,469,728 (GRCm39) missense probably benign 0.10
IGL02187:Adamts18 APN 8 114,439,826 (GRCm39) missense possibly damaging 0.93
IGL02551:Adamts18 APN 8 114,425,704 (GRCm39) missense probably damaging 1.00
IGL02756:Adamts18 APN 8 114,440,976 (GRCm39) splice site probably benign
IGL03188:Adamts18 APN 8 114,425,656 (GRCm39) missense probably damaging 1.00
IGL03411:Adamts18 APN 8 114,490,929 (GRCm39) nonsense probably null
G1patch:Adamts18 UTSW 8 114,469,833 (GRCm39) missense probably damaging 1.00
R0119:Adamts18 UTSW 8 114,501,585 (GRCm39) missense possibly damaging 0.94
R0410:Adamts18 UTSW 8 114,440,990 (GRCm39) nonsense probably null
R0480:Adamts18 UTSW 8 114,465,450 (GRCm39) missense possibly damaging 0.93
R0514:Adamts18 UTSW 8 114,465,401 (GRCm39) splice site probably null
R0924:Adamts18 UTSW 8 114,432,028 (GRCm39) splice site probably null
R0930:Adamts18 UTSW 8 114,432,028 (GRCm39) splice site probably null
R1333:Adamts18 UTSW 8 114,431,805 (GRCm39) splice site probably benign
R1441:Adamts18 UTSW 8 114,481,194 (GRCm39) critical splice donor site probably null
R2082:Adamts18 UTSW 8 114,501,965 (GRCm39) missense probably damaging 1.00
R2146:Adamts18 UTSW 8 114,571,635 (GRCm39) missense possibly damaging 0.58
R2371:Adamts18 UTSW 8 114,431,893 (GRCm39) missense probably benign 0.36
R3148:Adamts18 UTSW 8 114,465,490 (GRCm39) missense probably damaging 1.00
R3963:Adamts18 UTSW 8 114,504,443 (GRCm39) missense probably benign 0.00
R4056:Adamts18 UTSW 8 114,464,212 (GRCm39) nonsense probably null
R4486:Adamts18 UTSW 8 114,439,825 (GRCm39) missense probably benign 0.00
R4608:Adamts18 UTSW 8 114,464,245 (GRCm39) missense probably damaging 1.00
R4624:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4626:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4627:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4628:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4629:Adamts18 UTSW 8 114,499,800 (GRCm39) nonsense probably null
R4710:Adamts18 UTSW 8 114,433,558 (GRCm39) missense probably damaging 0.98
R4959:Adamts18 UTSW 8 114,463,357 (GRCm39) nonsense probably null
R4973:Adamts18 UTSW 8 114,463,357 (GRCm39) nonsense probably null
R4976:Adamts18 UTSW 8 114,425,642 (GRCm39) missense probably benign 0.31
R5119:Adamts18 UTSW 8 114,425,642 (GRCm39) missense probably benign 0.31
R5141:Adamts18 UTSW 8 114,501,902 (GRCm39) missense probably damaging 1.00
R5422:Adamts18 UTSW 8 114,425,606 (GRCm39) missense probably benign 0.06
R5587:Adamts18 UTSW 8 114,501,992 (GRCm39) nonsense probably null
R5868:Adamts18 UTSW 8 114,504,380 (GRCm39) missense possibly damaging 0.69
R5893:Adamts18 UTSW 8 114,499,709 (GRCm39) missense probably damaging 1.00
R5906:Adamts18 UTSW 8 114,436,251 (GRCm39) missense probably benign 0.00
R5942:Adamts18 UTSW 8 114,504,380 (GRCm39) missense probably benign 0.01
R6006:Adamts18 UTSW 8 114,433,606 (GRCm39) missense probably damaging 1.00
R6608:Adamts18 UTSW 8 114,501,911 (GRCm39) missense probably damaging 1.00
R6725:Adamts18 UTSW 8 114,469,833 (GRCm39) missense probably damaging 1.00
R7002:Adamts18 UTSW 8 114,501,922 (GRCm39) missense possibly damaging 0.69
R7276:Adamts18 UTSW 8 114,501,896 (GRCm39) missense probably damaging 0.99
R7292:Adamts18 UTSW 8 114,436,277 (GRCm39) missense probably benign 0.00
R7411:Adamts18 UTSW 8 114,504,362 (GRCm39) missense probably damaging 0.99
R7685:Adamts18 UTSW 8 114,439,855 (GRCm39) missense probably damaging 1.00
R7737:Adamts18 UTSW 8 114,463,566 (GRCm39) splice site probably null
R7860:Adamts18 UTSW 8 114,501,908 (GRCm39) missense probably damaging 1.00
R7936:Adamts18 UTSW 8 114,493,760 (GRCm39) missense probably damaging 1.00
R8197:Adamts18 UTSW 8 114,481,227 (GRCm39) missense probably damaging 1.00
R8363:Adamts18 UTSW 8 114,493,795 (GRCm39) missense probably damaging 1.00
R8759:Adamts18 UTSW 8 114,433,624 (GRCm39) missense probably damaging 1.00
R8934:Adamts18 UTSW 8 114,463,510 (GRCm39) missense possibly damaging 0.90
R9405:Adamts18 UTSW 8 114,430,030 (GRCm39) missense probably damaging 1.00
R9422:Adamts18 UTSW 8 114,501,910 (GRCm39) missense probably damaging 1.00
R9450:Adamts18 UTSW 8 114,490,942 (GRCm39) missense probably benign 0.10
R9475:Adamts18 UTSW 8 114,504,570 (GRCm39) missense possibly damaging 0.93
Z1088:Adamts18 UTSW 8 114,502,072 (GRCm39) missense possibly damaging 0.86
Z1176:Adamts18 UTSW 8 114,469,800 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TCAACGGTACATTTAAGGCCGGG -3'
(R):5'- ACTGTGACCACAGAGTCTCTGACAC -3'

Sequencing Primer
(F):5'- ggggggggggAAGACTG -3'
(R):5'- AGGCCATATTAAGTCCCTGTG -3'
Posted On 2013-05-09