Incidental Mutation 'R0378:Tmem108'
ID36475
Institutional Source Beutler Lab
Gene Symbol Tmem108
Ensembl Gene ENSMUSG00000042757
Gene Nametransmembrane protein 108
SynonymsB130017P16Rik
MMRRC Submission 038584-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0378 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location103482947-103761837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103499657 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 198 (R198G)
Ref Sequence ENSEMBL: ENSMUSP00000140027 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049452] [ENSMUST00000189066] [ENSMUST00000189588]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049452
AA Change: R198G

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000046021
Gene: ENSMUSG00000042757
AA Change: R198G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:TMEM108 61 574 1.6e-275 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000189066
AA Change: R198G

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000141160
Gene: ENSMUSG00000042757
AA Change: R198G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 132 179 N/A INTRINSIC
low complexity region 292 314 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000189588
AA Change: R198G

PolyPhen 2 Score 0.711 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000140027
Gene: ENSMUSG00000042757
AA Change: R198G

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 132 179 N/A INTRINSIC
low complexity region 292 314 N/A INTRINSIC
low complexity region 391 410 N/A INTRINSIC
transmembrane domain 468 490 N/A INTRINSIC
Meta Mutation Damage Score 0.1052 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype PHENOTYPE: Mice with drastically reduced expression exhibit decreased excitatory postsynaptic currents of dentate gyrate granule neurons, impaired sensorimotor gating, and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 C A 8: 113,743,117 R651L probably damaging Het
Amd1 T C 10: 40,289,384 D317G possibly damaging Het
Artn A G 4: 117,927,618 probably benign Het
Asna1 A T 8: 85,025,264 M1K probably null Het
Bub1b T A 2: 118,641,123 V988E probably benign Het
Cyp2c65 G T 19: 39,073,218 C216F probably benign Het
Cyp3a11 T C 5: 145,868,607 E200G probably benign Het
Cyp3a25 T A 5: 145,986,842 K330N probably damaging Het
Duox2 C A 2: 122,284,583 V1138L probably benign Het
Erc2 A G 14: 28,011,694 D567G probably damaging Het
Eri2 A G 7: 119,793,916 probably null Het
Foxa3 A G 7: 19,023,369 Y17H probably damaging Het
Fto T C 8: 91,474,312 S324P probably damaging Het
Gls2 T G 10: 128,207,311 L457R probably benign Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Gtf3c1 G A 7: 125,647,614 R1508* probably null Het
Kif21a T C 15: 90,969,774 probably null Het
Klra5 A T 6: 129,906,614 D93E possibly damaging Het
Lgr5 T C 10: 115,454,499 D456G probably damaging Het
Mau2 A G 8: 70,030,655 S186P probably damaging Het
Msr1 T C 8: 39,589,382 D384G possibly damaging Het
Mum1 C A 10: 80,238,879 probably null Het
Ncf4 T C 15: 78,253,303 V93A probably damaging Het
Oas1f T G 5: 120,856,426 C337G probably damaging Het
Olfr119 A G 17: 37,701,041 M124V probably damaging Het
Olfr482 A T 7: 108,095,222 F116Y probably benign Het
Olfr820 T A 10: 130,018,003 L214H probably damaging Het
Rasl10b T C 11: 83,418,693 S159P probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Smg8 C A 11: 87,080,423 D841Y probably damaging Het
Sox7 T C 14: 63,943,949 V65A probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Srsf10 A G 4: 135,863,190 Y142C possibly damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tcerg1l A G 7: 138,276,655 V326A probably benign Het
Tcl1b5 T A 12: 105,179,067 W97R probably damaging Het
Ube2ql1 T A 13: 69,738,898 Q148L possibly damaging Het
Vmn1r5 A T 6: 56,985,585 I82L probably benign Het
Wdr6 A T 9: 108,575,864 S273R probably damaging Het
Ylpm1 C T 12: 84,997,076 probably benign Het
Zfp90 G A 8: 106,425,506 R617Q possibly damaging Het
Other mutations in Tmem108
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01633:Tmem108 APN 9 103484751 missense probably benign 0.04
IGL02008:Tmem108 APN 9 103489240 missense possibly damaging 0.85
IGL02318:Tmem108 APN 9 103499782 missense probably benign 0.14
R0019:Tmem108 UTSW 9 103489340 missense possibly damaging 0.93
R0092:Tmem108 UTSW 9 103489305 missense possibly damaging 0.71
R0781:Tmem108 UTSW 9 103484690 missense probably damaging 0.98
R1138:Tmem108 UTSW 9 103498969 missense possibly damaging 0.71
R2090:Tmem108 UTSW 9 103484777 missense possibly damaging 0.57
R2137:Tmem108 UTSW 9 103499963 missense possibly damaging 0.71
R2520:Tmem108 UTSW 9 103489282 missense possibly damaging 0.85
R4724:Tmem108 UTSW 9 103499489 missense possibly damaging 0.86
R4883:Tmem108 UTSW 9 103499077 missense possibly damaging 0.93
R5358:Tmem108 UTSW 9 103499518 missense probably damaging 0.98
R6337:Tmem108 UTSW 9 103499761 missense possibly damaging 0.95
R6888:Tmem108 UTSW 9 103499716 missense probably damaging 1.00
R7223:Tmem108 UTSW 9 103499534 missense not run
Predicted Primers PCR Primer
(F):5'- TCAGGTGTGACAGCAAGCCAAG -3'
(R):5'- TATCTCATCCAGAAGGGCACCCTC -3'

Sequencing Primer
(F):5'- TGATAAAGCCTGGCTTGTCC -3'
(R):5'- GACACCACGTCTACAGTGATGG -3'
Posted On2013-05-09