Mutagenetix > Incidental Mutations

Incidental Mutation 'R0378:Lgr5'

36478

Institutional Source

Beutler Lab

Gene Symbol

Lgr5

Ensembl Gene

ENSMUSG00000020140

Gene Name

leucine rich repeat containing G protein coupled receptor 5

Synonyms

Gpr49

MMRRC Submission

038584-MU

Accession Numbers

Ncbi RefSeq: NM_010195.2; MGI: 1341817

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0378 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115450311-115587780 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 115454499 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 456 (D456G)

Ref Sequence

ENSEMBL: ENSMUSP00000133707 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020350] [ENSMUST00000172806] [ENSMUST00000173740]

Predicted Effect

probably benign
Transcript: ENSMUST00000020350
AA Change: D528G

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000020350
Gene: ENSMUSG00000020140
AA Change: D528G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
LRRNT	33	70	1.43e-5	SMART
LRR	64	88	1.41e2	SMART
LRR_TYP	89	112	3.44e-4	SMART
LRR_TYP	113	136	9.88e-5	SMART
LRR_TYP	137	160	9.73e-4	SMART
LRR_TYP	161	184	5.21e-4	SMART
LRR	185	208	6.22e0	SMART
LRR_TYP	209	232	3.89e-3	SMART
LRR	233	255	9.75e0	SMART
LRR_TYP	256	279	1.38e-3	SMART
Blast:LRR	281	303	2e-6	BLAST
Blast:LRR	304	328	1e-5	BLAST
LRR_TYP	351	374	1.56e-2	SMART
LRR	375	396	1.09e2	SMART
LRR_TYP	397	420	7.26e-3	SMART
LRR	421	444	2.86e-1	SMART
low complexity region	518	533	N/A	INTRINSIC
Pfam:7tm_1	574	820	9.5e-7	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144732

Predicted Effect

probably benign
Transcript: ENSMUST00000172806
AA Change: D504G

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000133860
Gene: ENSMUSG00000020140
AA Change: D504G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
LRRNT	33	70	1.43e-5	SMART
LRR	64	88	1.41e2	SMART
LRR_TYP	89	112	3.44e-4	SMART
LRR_TYP	113	136	9.88e-5	SMART
LRR_TYP	137	160	9.73e-4	SMART
LRR_TYP	161	184	5.21e-4	SMART
LRR	185	208	6.22e0	SMART
LRR_TYP	209	232	3.89e-3	SMART
LRR	233	255	9.75e0	SMART
LRR	256	279	6.57e-1	SMART
Blast:LRR	280	304	1e-5	BLAST
LRR_TYP	327	350	1.56e-2	SMART
LRR	351	372	1.09e2	SMART
LRR_TYP	373	396	7.26e-3	SMART
LRR	397	420	2.86e-1	SMART
low complexity region	494	509	N/A	INTRINSIC
Pfam:7tm_1	550	796	8.2e-16	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173619

Predicted Effect

probably damaging
Transcript: ENSMUST00000173740
AA Change: D456G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133707
Gene: ENSMUSG00000020140
AA Change: D456G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
LRRNT	33	70	1.43e-5	SMART
LRR	64	88	1.41e2	SMART
LRR_TYP	89	112	3.44e-4	SMART
LRR_TYP	113	136	9.88e-5	SMART
LRR_TYP	137	160	9.08e-4	SMART
LRR	161	183	9.75e0	SMART
LRR_TYP	184	207	1.38e-3	SMART
Blast:LRR	209	231	1e-6	BLAST
Blast:LRR	232	256	1e-5	BLAST
LRR_TYP	279	302	1.56e-2	SMART
LRR	303	324	1.09e2	SMART
LRR_TYP	325	348	7.26e-3	SMART
LRR	349	372	2.86e-1	SMART
low complexity region	446	461	N/A	INTRINSIC
Pfam:7tm_1	502	748	7.4e-16	PFAM

Meta Mutation Damage Score

0.1097

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.0%
20x: 94.8%

Validation Efficiency

95% (40/42)

MGI Phenotype

Strain: 3512420
Lethality: D1-D2
FUNCTION: The protein encoded by this gene is a leucine-rich repeat-containing receptor (LGR) and member of the G protein-coupled, 7-transmembrane receptor (GPCR) superfamily. The encoded protein is a receptor for R-spondins and is involved in the canonical Wnt signaling pathway. This protein plays a role in the formation and maintenance of adult intestinal stem cells during postembryonic development. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display 100% neonatal lethality associated with ankyloglossia, gastrointestinal distension, cyanosis and respiratory failure. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(7)

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts18	C	A	8: 113,743,117	R651L	probably damaging	Het
Amd1	T	C	10: 40,289,384	D317G	possibly damaging	Het
Artn	A	G	4: 117,927,618		probably benign	Het
Asna1	A	T	8: 85,025,264	M1K	probably null	Het
Bub1b	T	A	2: 118,641,123	V988E	probably benign	Het
Cyp2c65	G	T	19: 39,073,218	C216F	probably benign	Het
Cyp3a11	T	C	5: 145,868,607	E200G	probably benign	Het
Cyp3a25	T	A	5: 145,986,842	K330N	probably damaging	Het
Duox2	C	A	2: 122,284,583	V1138L	probably benign	Het
Erc2	A	G	14: 28,011,694	D567G	probably damaging	Het
Eri2	A	G	7: 119,793,916		probably null	Het
Foxa3	A	G	7: 19,023,369	Y17H	probably damaging	Het
Fto	T	C	8: 91,474,312	S324P	probably damaging	Het
Gls2	T	G	10: 128,207,311	L457R	probably benign	Het
Gstcd	A	T	3: 132,986,408	L582H	probably damaging	Het
Gtf3c1	G	A	7: 125,647,614	R1508*	probably null	Het
Kif21a	T	C	15: 90,969,774		probably null	Het
Klra5	A	T	6: 129,906,614	D93E	possibly damaging	Het
Mau2	A	G	8: 70,030,655	S186P	probably damaging	Het
Msr1	T	C	8: 39,589,382	D384G	possibly damaging	Het
Mum1	C	A	10: 80,238,879		probably null	Het
Ncf4	T	C	15: 78,253,303	V93A	probably damaging	Het
Oas1f	T	G	5: 120,856,426	C337G	probably damaging	Het
Olfr119	A	G	17: 37,701,041	M124V	probably damaging	Het
Olfr482	A	T	7: 108,095,222	F116Y	probably benign	Het
Olfr820	T	A	10: 130,018,003	L214H	probably damaging	Het
Rasl10b	T	C	11: 83,418,693	S159P	probably damaging	Het
Sephs1	A	G	2: 4,899,560	T250A	probably benign	Het
Smg8	C	A	11: 87,080,423	D841Y	probably damaging	Het
Sox7	T	C	14: 63,943,949	V65A	probably damaging	Het
Sp140	C	T	1: 85,620,051		probably benign	Het
Srsf10	A	G	4: 135,863,190	Y142C	possibly damaging	Het
Tcam1	G	A	11: 106,284,078	E120K	probably benign	Het
Tcerg1l	A	G	7: 138,276,655	V326A	probably benign	Het
Tcl1b5	T	A	12: 105,179,067	W97R	probably damaging	Het
Tmem108	T	C	9: 103,499,657	R198G	possibly damaging	Het
Ube2ql1	T	A	13: 69,738,898	Q148L	possibly damaging	Het
Vmn1r5	A	T	6: 56,985,585	I82L	probably benign	Het
Wdr6	A	T	9: 108,575,864	S273R	probably damaging	Het
Ylpm1	C	T	12: 84,997,076		probably benign	Het
Zfp90	G	A	8: 106,425,506	R617Q	possibly damaging	Het

Other mutations in Lgr5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Lgr5	APN	10	115454464	missense	possibly damaging	0.69
IGL01291:Lgr5	APN	10	115478534	missense	probably damaging	1.00
IGL01432:Lgr5	APN	10	115453092	missense	probably damaging	1.00
IGL01778:Lgr5	APN	10	115462702	missense	probably damaging	0.97
IGL01936:Lgr5	APN	10	115452414	missense	probably damaging	1.00
IGL02079:Lgr5	APN	10	115452194	missense	probably damaging	1.00
IGL02134:Lgr5	APN	10	115452858	missense	possibly damaging	0.89
IGL03083:Lgr5	APN	10	115453032	missense	probably benign	0.26
IGL03350:Lgr5	APN	10	115471988	missense	probably damaging	0.99
anger	UTSW	10	115466346	missense	probably benign	0.03
ANU05:Lgr5	UTSW	10	115478534	missense	probably damaging	1.00
R0788:Lgr5	UTSW	10	115452997	missense	probably damaging	0.99
R1119:Lgr5	UTSW	10	115460811	critical splice donor site	probably null
R1321:Lgr5	UTSW	10	115478457	missense	probably damaging	1.00
R1880:Lgr5	UTSW	10	115452279	missense	probably damaging	1.00
R1985:Lgr5	UTSW	10	115495245	splice site	probably benign
R2434:Lgr5	UTSW	10	115587406	missense	probably benign
R3055:Lgr5	UTSW	10	115466123	splice site	probably benign
R3910:Lgr5	UTSW	10	115587463	missense	possibly damaging	0.93
R4686:Lgr5	UTSW	10	115458743	intron	probably benign
R4862:Lgr5	UTSW	10	115462764	missense	probably damaging	1.00
R4866:Lgr5	UTSW	10	115452685	missense	probably benign	0.00
R5089:Lgr5	UTSW	10	115478423	missense	probably damaging	1.00
R5118:Lgr5	UTSW	10	115452339	missense	possibly damaging	0.88
R5375:Lgr5	UTSW	10	115478564	missense	probably benign	0.00
R5537:Lgr5	UTSW	10	115456689	missense	probably benign	0.00
R5583:Lgr5	UTSW	10	115478504	missense	probably benign	0.32
R6312:Lgr5	UTSW	10	115452924	missense	probably damaging	1.00
R6362:Lgr5	UTSW	10	115478525	missense	probably damaging	1.00
R6605:Lgr5	UTSW	10	115457867	missense	possibly damaging	0.69
R6689:Lgr5	UTSW	10	115466608	missense	probably damaging	0.99
R6705:Lgr5	UTSW	10	115587288	missense	probably damaging	0.96
R6925:Lgr5	UTSW	10	115466346	missense	probably benign	0.03
R7063:Lgr5	UTSW	10	115456734	missense	probably damaging	1.00
R7261:Lgr5	UTSW	10	115587465	missense	possibly damaging	0.96
R7274:Lgr5	UTSW	10	115452505	missense	probably damaging	0.99
R7458:Lgr5	UTSW	10	115457755	critical splice donor site	probably null
R7569:Lgr5	UTSW	10	115462756	missense	probably damaging	1.00
R7770:Lgr5	UTSW	10	115471994	missense	probably damaging	0.98
R7936:Lgr5	UTSW	10	115453047	missense	probably damaging	0.99
R7964:Lgr5	UTSW	10	115452174	missense	probably benign	0.00
R8085:Lgr5	UTSW	10	115475197	missense	probably benign
R8537:Lgr5	UTSW	10	115452402	missense	probably damaging	1.00
Z1176:Lgr5	UTSW	10	115460876	missense	probably damaging	0.98
Z1177:Lgr5	UTSW	10	115456669	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GTTTGTATCAGCCCGAGTCAGCAG -3'
(R):5'- GAACATCCACGAGGAACCTTCTAGC -3'

Sequencing Primer
(F):5'- GCAGGTCTCCACACAAGTTC -3'
(R):5'- GAACCTTCTAGCCGACCTG -3'

Posted On

2013-05-09