Incidental Mutation 'R0378:Olfr820'
ID36480
Institutional Source Beutler Lab
Gene Symbol Olfr820
Ensembl Gene ENSMUSG00000048745
Gene Nameolfactory receptor 820
SynonymsGA_x6K02T2PULF-11688441-11689379, MOR116-1
MMRRC Submission 038584-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R0378 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location130012621-130021286 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130018003 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 214 (L214H)
Ref Sequence ENSEMBL: ENSMUSP00000150332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059244] [ENSMUST00000214917] [ENSMUST00000215791]
Predicted Effect probably damaging
Transcript: ENSMUST00000059244
AA Change: L214H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000052995
Gene: ENSMUSG00000048745
AA Change: L214H

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1e-47 PFAM
Pfam:7tm_1 39 288 1.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214917
AA Change: L214H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215791
AA Change: L214H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.3380 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 C A 8: 113,743,117 R651L probably damaging Het
Amd1 T C 10: 40,289,384 D317G possibly damaging Het
Artn A G 4: 117,927,618 probably benign Het
Asna1 A T 8: 85,025,264 M1K probably null Het
Bub1b T A 2: 118,641,123 V988E probably benign Het
Cyp2c65 G T 19: 39,073,218 C216F probably benign Het
Cyp3a11 T C 5: 145,868,607 E200G probably benign Het
Cyp3a25 T A 5: 145,986,842 K330N probably damaging Het
Duox2 C A 2: 122,284,583 V1138L probably benign Het
Erc2 A G 14: 28,011,694 D567G probably damaging Het
Eri2 A G 7: 119,793,916 probably null Het
Foxa3 A G 7: 19,023,369 Y17H probably damaging Het
Fto T C 8: 91,474,312 S324P probably damaging Het
Gls2 T G 10: 128,207,311 L457R probably benign Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Gtf3c1 G A 7: 125,647,614 R1508* probably null Het
Kif21a T C 15: 90,969,774 probably null Het
Klra5 A T 6: 129,906,614 D93E possibly damaging Het
Lgr5 T C 10: 115,454,499 D456G probably damaging Het
Mau2 A G 8: 70,030,655 S186P probably damaging Het
Msr1 T C 8: 39,589,382 D384G possibly damaging Het
Mum1 C A 10: 80,238,879 probably null Het
Ncf4 T C 15: 78,253,303 V93A probably damaging Het
Oas1f T G 5: 120,856,426 C337G probably damaging Het
Olfr119 A G 17: 37,701,041 M124V probably damaging Het
Olfr482 A T 7: 108,095,222 F116Y probably benign Het
Rasl10b T C 11: 83,418,693 S159P probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Smg8 C A 11: 87,080,423 D841Y probably damaging Het
Sox7 T C 14: 63,943,949 V65A probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Srsf10 A G 4: 135,863,190 Y142C possibly damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tcerg1l A G 7: 138,276,655 V326A probably benign Het
Tcl1b5 T A 12: 105,179,067 W97R probably damaging Het
Tmem108 T C 9: 103,499,657 R198G possibly damaging Het
Ube2ql1 T A 13: 69,738,898 Q148L possibly damaging Het
Vmn1r5 A T 6: 56,985,585 I82L probably benign Het
Wdr6 A T 9: 108,575,864 S273R probably damaging Het
Ylpm1 C T 12: 84,997,076 probably benign Het
Zfp90 G A 8: 106,425,506 R617Q possibly damaging Het
Other mutations in Olfr820
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Olfr820 APN 10 130017841 missense probably damaging 0.98
IGL01938:Olfr820 APN 10 130018112 nonsense probably null
IGL02369:Olfr820 APN 10 130017556 missense possibly damaging 0.81
R0437:Olfr820 UTSW 10 130018096 missense probably damaging 1.00
R0648:Olfr820 UTSW 10 130017481 missense probably damaging 1.00
R1891:Olfr820 UTSW 10 130017570 missense probably damaging 1.00
R2187:Olfr820 UTSW 10 130017688 missense probably damaging 1.00
R4190:Olfr820 UTSW 10 130017978 missense probably damaging 0.96
R4730:Olfr820 UTSW 10 130017547 missense probably damaging 1.00
R6380:Olfr820 UTSW 10 130017913 missense probably benign 0.18
R6496:Olfr820 UTSW 10 130017579 missense probably benign 0.13
R7198:Olfr820 UTSW 10 130017891 missense probably damaging 1.00
R7667:Olfr820 UTSW 10 130017534 missense probably damaging 1.00
R7762:Olfr820 UTSW 10 130017181 intron probably benign
R7823:Olfr820 UTSW 10 130018267 missense probably benign 0.00
Z1177:Olfr820 UTSW 10 130017985 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCGGAGACTTTGCTTCCAAC -3'
(R):5'- TGTAGATGAATGGGTTTAACAGAGGTGC -3'

Sequencing Primer
(F):5'- GTTGCTGTGCCACATGC -3'
(R):5'- GCAACAGAGGTATTTAAAACAGCTAC -3'
Posted On2013-05-09