Incidental Mutation 'R0378:Rasl10b'
ID36481
Institutional Source Beutler Lab
Gene Symbol Rasl10b
Ensembl Gene ENSMUSG00000020684
Gene NameRAS-like, family 10, member B
SynonymsB230331P10Rik, VTS58635
MMRRC Submission 038584-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R0378 (G1)
Quality Score101
Status Validated
Chromosome11
Chromosomal Location83409137-83421039 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83418693 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 159 (S159P)
Ref Sequence ENSEMBL: ENSMUSP00000132696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021022] [ENSMUST00000052521] [ENSMUST00000108140] [ENSMUST00000147301] [ENSMUST00000164425] [ENSMUST00000175848]
Predicted Effect probably damaging
Transcript: ENSMUST00000021022
AA Change: S159P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021022
Gene: ENSMUSG00000020684
AA Change: S159P

DomainStartEndE-ValueType
Pfam:Miro 6 131 2.7e-16 PFAM
Pfam:Ras 6 178 1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052521
SMART Domains Protein: ENSMUSP00000051907
Gene: ENSMUSG00000020686

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
CH 34 154 2.15e-15 SMART
low complexity region 167 200 N/A INTRINSIC
Pfam:GAS2 206 274 1.2e-35 PFAM
low complexity region 444 460 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 817 827 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108140
AA Change: S159P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103775
Gene: ENSMUSG00000020684
AA Change: S159P

DomainStartEndE-ValueType
Pfam:Miro 6 131 2.7e-16 PFAM
Pfam:Ras 6 178 1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147301
SMART Domains Protein: ENSMUSP00000119454
Gene: ENSMUSG00000020686

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
CH 34 154 2.15e-15 SMART
low complexity region 167 185 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164425
AA Change: S159P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132696
Gene: ENSMUSG00000020684
AA Change: S159P

DomainStartEndE-ValueType
Pfam:Ras 6 178 6.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175848
SMART Domains Protein: ENSMUSP00000135803
Gene: ENSMUSG00000020684

DomainStartEndE-ValueType
Pfam:Ras 6 120 2.3e-12 PFAM
Pfam:Miro 6 123 8.2e-13 PFAM
Meta Mutation Damage Score 0.9088 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele have smaller than normal large dense-core vesicles in atrial myocytes and exhibit impaired atrial natriuretic peptide secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 C A 8: 113,743,117 R651L probably damaging Het
Amd1 T C 10: 40,289,384 D317G possibly damaging Het
Artn A G 4: 117,927,618 probably benign Het
Asna1 A T 8: 85,025,264 M1K probably null Het
Bub1b T A 2: 118,641,123 V988E probably benign Het
Cyp2c65 G T 19: 39,073,218 C216F probably benign Het
Cyp3a11 T C 5: 145,868,607 E200G probably benign Het
Cyp3a25 T A 5: 145,986,842 K330N probably damaging Het
Duox2 C A 2: 122,284,583 V1138L probably benign Het
Erc2 A G 14: 28,011,694 D567G probably damaging Het
Eri2 A G 7: 119,793,916 probably null Het
Foxa3 A G 7: 19,023,369 Y17H probably damaging Het
Fto T C 8: 91,474,312 S324P probably damaging Het
Gls2 T G 10: 128,207,311 L457R probably benign Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Gtf3c1 G A 7: 125,647,614 R1508* probably null Het
Kif21a T C 15: 90,969,774 probably null Het
Klra5 A T 6: 129,906,614 D93E possibly damaging Het
Lgr5 T C 10: 115,454,499 D456G probably damaging Het
Mau2 A G 8: 70,030,655 S186P probably damaging Het
Msr1 T C 8: 39,589,382 D384G possibly damaging Het
Mum1 C A 10: 80,238,879 probably null Het
Ncf4 T C 15: 78,253,303 V93A probably damaging Het
Oas1f T G 5: 120,856,426 C337G probably damaging Het
Olfr119 A G 17: 37,701,041 M124V probably damaging Het
Olfr482 A T 7: 108,095,222 F116Y probably benign Het
Olfr820 T A 10: 130,018,003 L214H probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Smg8 C A 11: 87,080,423 D841Y probably damaging Het
Sox7 T C 14: 63,943,949 V65A probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Srsf10 A G 4: 135,863,190 Y142C possibly damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tcerg1l A G 7: 138,276,655 V326A probably benign Het
Tcl1b5 T A 12: 105,179,067 W97R probably damaging Het
Tmem108 T C 9: 103,499,657 R198G possibly damaging Het
Ube2ql1 T A 13: 69,738,898 Q148L possibly damaging Het
Vmn1r5 A T 6: 56,985,585 I82L probably benign Het
Wdr6 A T 9: 108,575,864 S273R probably damaging Het
Ylpm1 C T 12: 84,997,076 probably benign Het
Zfp90 G A 8: 106,425,506 R617Q possibly damaging Het
Other mutations in Rasl10b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Rasl10b APN 11 83417853 missense probably damaging 1.00
R0772:Rasl10b UTSW 11 83417839 splice site probably null
R0773:Rasl10b UTSW 11 83417839 splice site probably null
R0829:Rasl10b UTSW 11 83417839 splice site probably null
R0830:Rasl10b UTSW 11 83417839 splice site probably null
R0831:Rasl10b UTSW 11 83417839 splice site probably null
R1363:Rasl10b UTSW 11 83417839 splice site probably null
R1364:Rasl10b UTSW 11 83417839 splice site probably null
R1365:Rasl10b UTSW 11 83417839 splice site probably null
R1366:Rasl10b UTSW 11 83417839 splice site probably null
R1367:Rasl10b UTSW 11 83417839 splice site probably null
R1368:Rasl10b UTSW 11 83417839 splice site probably null
R1389:Rasl10b UTSW 11 83417839 splice site probably null
R3771:Rasl10b UTSW 11 83418523 missense probably benign 0.04
R4925:Rasl10b UTSW 11 83412679 missense probably damaging 1.00
R5625:Rasl10b UTSW 11 83418814 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCCCGACTTATGACGTTGGCTATAC -3'
(R):5'- TACAGCACTGAAGGTGACTGACCC -3'

Sequencing Primer
(F):5'- acatataagcctcagttttcttgtc -3'
(R):5'- TGACTGACCCAGGGAGAC -3'
Posted On2013-05-09