Mutagenetix > Incidental Mutations

Incidental Mutation 'R0378:Erc2'

36487

Institutional Source

Beutler Lab

Gene Symbol

Erc2

Ensembl Gene

ENSMUSG00000040640

Gene Name

ELKS/RAB6-interacting/CAST family member 2

Synonyms

ELKS2alpha, D14Ertd171e

MMRRC Submission

038584-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0378 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27622428-28478537 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 28011694 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 567 (D567G)

Ref Sequence

ENSEMBL: ENSMUSP00000147886 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090302] [ENSMUST00000210135] [ENSMUST00000210924] [ENSMUST00000211145]

Predicted Effect

probably damaging
Transcript: ENSMUST00000090302
AA Change: D567G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000087773
Gene: ENSMUSG00000040640
AA Change: D567G

Domain	Start	End	E-Value	Type
low complexity region	14	45	N/A	INTRINSIC
low complexity region	121	133	N/A	INTRINSIC
Pfam:Cast	150	907	N/A	PFAM
low complexity region	916	928	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000210135
AA Change: D575G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000210924
AA Change: D233G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211145
AA Change: D567G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211627

Meta Mutation Damage Score

0.0739

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.0%
20x: 94.8%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Rab3-interacting molecule (RIM)-binding protein family. Members of this protein family form part of the cytomatrix at the active zone (CAZ) complex and function as regulators of neurotransmitter release. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for targeted disruptions of this gene are viable and fertile. However, homozygotes for one allele display abnormal CNS synaptic transmission. Homozygotes for a second allele display retinal abnormalities and impaired vision. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts18	C	A	8: 113,743,117	R651L	probably damaging	Het
Amd1	T	C	10: 40,289,384	D317G	possibly damaging	Het
Artn	A	G	4: 117,927,618		probably benign	Het
Asna1	A	T	8: 85,025,264	M1K	probably null	Het
Bub1b	T	A	2: 118,641,123	V988E	probably benign	Het
Cyp2c65	G	T	19: 39,073,218	C216F	probably benign	Het
Cyp3a11	T	C	5: 145,868,607	E200G	probably benign	Het
Cyp3a25	T	A	5: 145,986,842	K330N	probably damaging	Het
Duox2	C	A	2: 122,284,583	V1138L	probably benign	Het
Eri2	A	G	7: 119,793,916		probably null	Het
Foxa3	A	G	7: 19,023,369	Y17H	probably damaging	Het
Fto	T	C	8: 91,474,312	S324P	probably damaging	Het
Gls2	T	G	10: 128,207,311	L457R	probably benign	Het
Gstcd	A	T	3: 132,986,408	L582H	probably damaging	Het
Gtf3c1	G	A	7: 125,647,614	R1508*	probably null	Het
Kif21a	T	C	15: 90,969,774		probably null	Het
Klra5	A	T	6: 129,906,614	D93E	possibly damaging	Het
Lgr5	T	C	10: 115,454,499	D456G	probably damaging	Het
Mau2	A	G	8: 70,030,655	S186P	probably damaging	Het
Msr1	T	C	8: 39,589,382	D384G	possibly damaging	Het
Mum1	C	A	10: 80,238,879		probably null	Het
Ncf4	T	C	15: 78,253,303	V93A	probably damaging	Het
Oas1f	T	G	5: 120,856,426	C337G	probably damaging	Het
Olfr119	A	G	17: 37,701,041	M124V	probably damaging	Het
Olfr482	A	T	7: 108,095,222	F116Y	probably benign	Het
Olfr820	T	A	10: 130,018,003	L214H	probably damaging	Het
Rasl10b	T	C	11: 83,418,693	S159P	probably damaging	Het
Sephs1	A	G	2: 4,899,560	T250A	probably benign	Het
Smg8	C	A	11: 87,080,423	D841Y	probably damaging	Het
Sox7	T	C	14: 63,943,949	V65A	probably damaging	Het
Sp140	C	T	1: 85,620,051		probably benign	Het
Srsf10	A	G	4: 135,863,190	Y142C	possibly damaging	Het
Tcam1	G	A	11: 106,284,078	E120K	probably benign	Het
Tcerg1l	A	G	7: 138,276,655	V326A	probably benign	Het
Tcl1b5	T	A	12: 105,179,067	W97R	probably damaging	Het
Tmem108	T	C	9: 103,499,657	R198G	possibly damaging	Het
Ube2ql1	T	A	13: 69,738,898	Q148L	possibly damaging	Het
Vmn1r5	A	T	6: 56,985,585	I82L	probably benign	Het
Wdr6	A	T	9: 108,575,864	S273R	probably damaging	Het
Ylpm1	C	T	12: 84,997,076		probably benign	Het
Zfp90	G	A	8: 106,425,506	R617Q	possibly damaging	Het

Other mutations in Erc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00836:Erc2	APN	14	28040521	missense	probably damaging	0.98
IGL01862:Erc2	APN	14	28271569	splice site	probably benign
IGL01906:Erc2	APN	14	28141306	missense	probably damaging	0.99
IGL02177:Erc2	APN	14	27898623	missense	probably benign	0.00
IGL02481:Erc2	APN	14	27653071	missense	probably damaging	1.00
IGL02483:Erc2	APN	14	27653071	missense	probably damaging	1.00
IGL02623:Erc2	APN	14	27776980	missense	probably damaging	1.00
IGL03252:Erc2	APN	14	28475649	utr 3 prime	probably benign
IGL03378:Erc2	APN	14	28011723	missense	probably damaging	1.00
lobe	UTSW	14	28317251	missense	probably damaging	0.96
R0091:Erc2	UTSW	14	27776824	critical splice acceptor site	probably null
R0309:Erc2	UTSW	14	28141225	missense	probably damaging	0.98
R0357:Erc2	UTSW	14	27777022	missense	probably damaging	0.99
R0550:Erc2	UTSW	14	28271651	missense	possibly damaging	0.74
R0815:Erc2	UTSW	14	28025148	missense	probably benign	0.04
R0863:Erc2	UTSW	14	28025148	missense	probably benign	0.04
R1121:Erc2	UTSW	14	28475655	utr 3 prime	probably benign
R1164:Erc2	UTSW	14	28302972	missense	probably damaging	0.99
R1498:Erc2	UTSW	14	28302898	missense	probably benign	0.27
R1500:Erc2	UTSW	14	28271660	missense	probably damaging	0.98
R1555:Erc2	UTSW	14	28011665	missense	probably damaging	0.99
R1894:Erc2	UTSW	14	28141228	missense	probably damaging	0.99
R1950:Erc2	UTSW	14	27912900	missense	probably damaging	0.99
R1991:Erc2	UTSW	14	28011636	missense	probably benign	0.34
R2698:Erc2	UTSW	14	28271705	missense	probably benign	0.06
R2847:Erc2	UTSW	14	28040488	missense	probably damaging	0.97
R3015:Erc2	UTSW	14	28011775	critical splice donor site	probably null
R3612:Erc2	UTSW	14	27777177	missense	possibly damaging	0.69
R3759:Erc2	UTSW	14	28025163	missense	possibly damaging	0.94
R3857:Erc2	UTSW	14	28475642	utr 3 prime	probably benign
R3858:Erc2	UTSW	14	28475642	utr 3 prime	probably benign
R3859:Erc2	UTSW	14	28475642	utr 3 prime	probably benign
R4556:Erc2	UTSW	14	28302904	missense	probably damaging	1.00
R4739:Erc2	UTSW	14	27776881	missense	probably damaging	1.00
R4898:Erc2	UTSW	14	27653328	missense	probably damaging	1.00
R5068:Erc2	UTSW	14	28302943	missense	possibly damaging	0.63
R5113:Erc2	UTSW	14	27652872	missense	probably benign	0.40
R5418:Erc2	UTSW	14	27966510	missense	probably benign	0.14
R5741:Erc2	UTSW	14	28302869	splice site	probably null
R5819:Erc2	UTSW	14	28141369	missense	probably damaging	0.97
R5930:Erc2	UTSW	14	27776858	missense	probably damaging	0.99
R6073:Erc2	UTSW	14	28011636	missense	probably benign	0.00
R6150:Erc2	UTSW	14	28141291	missense	probably damaging	0.97
R6182:Erc2	UTSW	14	28317253	missense	probably damaging	0.99
R6188:Erc2	UTSW	14	28317251	missense	probably damaging	0.96
R6267:Erc2	UTSW	14	28080155	missense	probably damaging	1.00
R6296:Erc2	UTSW	14	28080155	missense	probably damaging	1.00
R6730:Erc2	UTSW	14	27898567	missense	possibly damaging	0.95
R6969:Erc2	UTSW	14	27898596	missense	probably damaging	1.00
R7095:Erc2	UTSW	14	27898593	missense	probably damaging	0.99
R7221:Erc2	UTSW	14	27653158	missense	probably damaging	0.97
R7365:Erc2	UTSW	14	28040389	missense	probably damaging	1.00
R7454:Erc2	UTSW	14	28302991	missense	possibly damaging	0.92
R7763:Erc2	UTSW	14	27876204	critical splice donor site	probably null
R7784:Erc2	UTSW	14	27898594	missense	probably damaging	0.96
R7890:Erc2	UTSW	14	28040341	critical splice acceptor site	probably null
R7894:Erc2	UTSW	14	27777208	missense	probably damaging	1.00
R8031:Erc2	UTSW	14	28011692	missense	probably damaging	0.99
R8206:Erc2	UTSW	14	28303015	splice site	probably null
R8273:Erc2	UTSW	14	27777139	missense	probably benign	0.41
R8304:Erc2	UTSW	14	27653165	missense	probably damaging	0.99
R8387:Erc2	UTSW	14	27653296	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- TACTCAGTGTCTGCCCAGTGAAGG -3'
(R):5'- TCCCCTGGCTAACATGGAAGTCTG -3'

Sequencing Primer
(F):5'- GCCCAGTGAAGGATTTAATCCTG -3'
(R):5'- CTGGGACTAGGGGCAGTG -3'

Posted On

2013-05-09