Incidental Mutation 'R0378:Sox7'
ID36488
Institutional Source Beutler Lab
Gene Symbol Sox7
Ensembl Gene ENSMUSG00000063060
Gene NameSRY (sex determining region Y)-box 7
Synonyms
MMRRC Submission 038584-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0378 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location63943673-63950732 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63943949 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 65 (V65A)
Ref Sequence ENSEMBL: ENSMUSP00000078597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079652]
Predicted Effect probably damaging
Transcript: ENSMUST00000079652
AA Change: V65A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078597
Gene: ENSMUSG00000063060
AA Change: V65A

DomainStartEndE-ValueType
HMG 44 114 8.74e-27 SMART
Pfam:Sox_C_TAD 171 378 1.4e-58 PFAM
Meta Mutation Damage Score 0.0763 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.0%
  • 20x: 94.8%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein may act as a transcriptional regulator after forming a protein complex with other proteins. The protein may play a role in tumorigenesis. A similar protein in mice is involved in the regulation of the wingless-type MMTV integration site family (Wnt) pathway. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most embryos homozygous for a knock-out allele exhibit embryonic growth retardation, abnormal vitelline vascular remodeling and pericardial edema, and die during organogenesis. Depending on the genetic background, a portion of heterozygotes can develop congenital retrosternal diaphragmatic hernias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 C A 8: 113,743,117 R651L probably damaging Het
Amd1 T C 10: 40,289,384 D317G possibly damaging Het
Artn A G 4: 117,927,618 probably benign Het
Asna1 A T 8: 85,025,264 M1K probably null Het
Bub1b T A 2: 118,641,123 V988E probably benign Het
Cyp2c65 G T 19: 39,073,218 C216F probably benign Het
Cyp3a11 T C 5: 145,868,607 E200G probably benign Het
Cyp3a25 T A 5: 145,986,842 K330N probably damaging Het
Duox2 C A 2: 122,284,583 V1138L probably benign Het
Erc2 A G 14: 28,011,694 D567G probably damaging Het
Eri2 A G 7: 119,793,916 probably null Het
Foxa3 A G 7: 19,023,369 Y17H probably damaging Het
Fto T C 8: 91,474,312 S324P probably damaging Het
Gls2 T G 10: 128,207,311 L457R probably benign Het
Gstcd A T 3: 132,986,408 L582H probably damaging Het
Gtf3c1 G A 7: 125,647,614 R1508* probably null Het
Kif21a T C 15: 90,969,774 probably null Het
Klra5 A T 6: 129,906,614 D93E possibly damaging Het
Lgr5 T C 10: 115,454,499 D456G probably damaging Het
Mau2 A G 8: 70,030,655 S186P probably damaging Het
Msr1 T C 8: 39,589,382 D384G possibly damaging Het
Mum1 C A 10: 80,238,879 probably null Het
Ncf4 T C 15: 78,253,303 V93A probably damaging Het
Oas1f T G 5: 120,856,426 C337G probably damaging Het
Olfr119 A G 17: 37,701,041 M124V probably damaging Het
Olfr482 A T 7: 108,095,222 F116Y probably benign Het
Olfr820 T A 10: 130,018,003 L214H probably damaging Het
Rasl10b T C 11: 83,418,693 S159P probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Smg8 C A 11: 87,080,423 D841Y probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Srsf10 A G 4: 135,863,190 Y142C possibly damaging Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tcerg1l A G 7: 138,276,655 V326A probably benign Het
Tcl1b5 T A 12: 105,179,067 W97R probably damaging Het
Tmem108 T C 9: 103,499,657 R198G possibly damaging Het
Ube2ql1 T A 13: 69,738,898 Q148L possibly damaging Het
Vmn1r5 A T 6: 56,985,585 I82L probably benign Het
Wdr6 A T 9: 108,575,864 S273R probably damaging Het
Ylpm1 C T 12: 84,997,076 probably benign Het
Zfp90 G A 8: 106,425,506 R617Q possibly damaging Het
Other mutations in Sox7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Sox7 APN 14 63948187 missense probably benign 0.00
R3147:Sox7 UTSW 14 63948634 missense probably damaging 1.00
R4350:Sox7 UTSW 14 63948546 missense probably benign 0.02
R4899:Sox7 UTSW 14 63948478 missense probably damaging 1.00
R5217:Sox7 UTSW 14 63948000 missense probably damaging 0.97
R5418:Sox7 UTSW 14 63947947 missense probably benign 0.30
R5477:Sox7 UTSW 14 63948496 missense probably damaging 1.00
R6603:Sox7 UTSW 14 63948188 missense probably benign 0.06
R7216:Sox7 UTSW 14 63947989 missense probably benign 0.42
R7312:Sox7 UTSW 14 63947842 missense probably damaging 1.00
R7812:Sox7 UTSW 14 63948232 missense probably benign 0.09
R8310:Sox7 UTSW 14 63943826 missense probably benign 0.03
Z1177:Sox7 UTSW 14 63947865 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CGGTGGCCCGAAGCTGATAAATAAG -3'
(R):5'- CTGGTGGTGTCTGTGTTCAAATCCC -3'

Sequencing Primer
(F):5'- TAAATAAGGGCCAAGCCCG -3'
(R):5'- TGTGTTCAAATCCCACCCC -3'
Posted On2013-05-09