Mutagenetix > Incidental Mutations

Incidental Mutation 'R0378:Ncf4'

36489

Institutional Source

Beutler Lab

Gene Symbol

Ncf4

Ensembl Gene

ENSMUSG00000071715

Gene Name

neutrophil cytosolic factor 4

Synonyms

p40phox

MMRRC Submission

038584-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0378 (G1)

Quality Score

178

Status

Validated

Chromosome

Chromosomal Location

78244801-78262580 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 78253303 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 93 (V93A)

Ref Sequence

ENSEMBL: ENSMUSP00000121191 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096357] [ENSMUST00000133618]

Predicted Effect

probably damaging
Transcript: ENSMUST00000096357
AA Change: V93A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000094084
Gene: ENSMUSG00000071715
AA Change: V93A

Domain	Start	End	E-Value	Type
PX	18	136	3.16e-28	SMART
SH3	173	228	2.24e-19	SMART
PB1	237	329	8.06e-16	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126028

Predicted Effect

probably damaging
Transcript: ENSMUST00000133618
AA Change: V93A

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000121191
Gene: ENSMUSG00000071715
AA Change: V93A

Domain	Start	End	E-Value	Type
PX	18	136	3.16e-28	SMART
SH3	173	228	2.24e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146147

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147303

Meta Mutation Damage Score

0.4808

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.0%
20x: 94.8%

Validation Efficiency

95% (40/42)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytosolic regulatory component of the superoxide-producing phagocyte NADPH-oxidase, a multicomponent enzyme system important for host defense. This protein is preferentially expressed in cells of myeloid lineage. It interacts primarily with neutrophil cytosolic factor 2 (NCF2/p67-phox) to form a complex with neutrophil cytosolic factor 1 (NCF1/p47-phox), which further interacts with the small G protein RAC1 and translocates to the membrane upon cell stimulation. This complex then activates flavocytochrome b, the membrane-integrated catalytic core of the enzyme system. The PX domain of this protein can bind phospholipid products of the PI(3) kinase, which suggests its role in PI(3) kinase-mediated signaling events. The phosphorylation of this protein was found to negatively regulate the enzyme activity. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele are viable but show impaired NADPH oxidase responses of neutrophils to a variety of stimuli and defective killing of S. aureus in vitro and in vivo. Homozygotes for a knock-in allele that prevents PtdIns3P binding to thePX domain fail in development prior to E10. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts18	C	A	8: 113,743,117	R651L	probably damaging	Het
Amd1	T	C	10: 40,289,384	D317G	possibly damaging	Het
Artn	A	G	4: 117,927,618		probably benign	Het
Asna1	A	T	8: 85,025,264	M1K	probably null	Het
Bub1b	T	A	2: 118,641,123	V988E	probably benign	Het
Cyp2c65	G	T	19: 39,073,218	C216F	probably benign	Het
Cyp3a11	T	C	5: 145,868,607	E200G	probably benign	Het
Cyp3a25	T	A	5: 145,986,842	K330N	probably damaging	Het
Duox2	C	A	2: 122,284,583	V1138L	probably benign	Het
Erc2	A	G	14: 28,011,694	D567G	probably damaging	Het
Eri2	A	G	7: 119,793,916		probably null	Het
Foxa3	A	G	7: 19,023,369	Y17H	probably damaging	Het
Fto	T	C	8: 91,474,312	S324P	probably damaging	Het
Gls2	T	G	10: 128,207,311	L457R	probably benign	Het
Gstcd	A	T	3: 132,986,408	L582H	probably damaging	Het
Gtf3c1	G	A	7: 125,647,614	R1508*	probably null	Het
Kif21a	T	C	15: 90,969,774		probably null	Het
Klra5	A	T	6: 129,906,614	D93E	possibly damaging	Het
Lgr5	T	C	10: 115,454,499	D456G	probably damaging	Het
Mau2	A	G	8: 70,030,655	S186P	probably damaging	Het
Msr1	T	C	8: 39,589,382	D384G	possibly damaging	Het
Mum1	C	A	10: 80,238,879		probably null	Het
Oas1f	T	G	5: 120,856,426	C337G	probably damaging	Het
Olfr119	A	G	17: 37,701,041	M124V	probably damaging	Het
Olfr482	A	T	7: 108,095,222	F116Y	probably benign	Het
Olfr820	T	A	10: 130,018,003	L214H	probably damaging	Het
Rasl10b	T	C	11: 83,418,693	S159P	probably damaging	Het
Sephs1	A	G	2: 4,899,560	T250A	probably benign	Het
Smg8	C	A	11: 87,080,423	D841Y	probably damaging	Het
Sox7	T	C	14: 63,943,949	V65A	probably damaging	Het
Sp140	C	T	1: 85,620,051		probably benign	Het
Srsf10	A	G	4: 135,863,190	Y142C	possibly damaging	Het
Tcam1	G	A	11: 106,284,078	E120K	probably benign	Het
Tcerg1l	A	G	7: 138,276,655	V326A	probably benign	Het
Tcl1b5	T	A	12: 105,179,067	W97R	probably damaging	Het
Tmem108	T	C	9: 103,499,657	R198G	possibly damaging	Het
Ube2ql1	T	A	13: 69,738,898	Q148L	possibly damaging	Het
Vmn1r5	A	T	6: 56,985,585	I82L	probably benign	Het
Wdr6	A	T	9: 108,575,864	S273R	probably damaging	Het
Ylpm1	C	T	12: 84,997,076		probably benign	Het
Zfp90	G	A	8: 106,425,506	R617Q	possibly damaging	Het

Other mutations in Ncf4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01935:Ncf4	APN	15	78255986	missense	probably damaging	1.00
IGL02546:Ncf4	APN	15	78261019	missense	probably damaging	1.00
IGL03064:Ncf4	APN	15	78250902	missense	probably damaging	1.00
IGL03407:Ncf4	APN	15	78254781	splice site	probably benign
R0281:Ncf4	UTSW	15	78250883	missense	probably damaging	0.96
R1513:Ncf4	UTSW	15	78262360	missense	probably benign
R1596:Ncf4	UTSW	15	78250437	missense	probably damaging	1.00
R1652:Ncf4	UTSW	15	78261034	missense	possibly damaging	0.83
R1815:Ncf4	UTSW	15	78250402	missense	probably benign	0.00
R1847:Ncf4	UTSW	15	78250382	missense	probably benign	0.33
R1927:Ncf4	UTSW	15	78260646	missense	probably damaging	1.00
R2984:Ncf4	UTSW	15	78262320	missense	probably benign	0.09
R4302:Ncf4	UTSW	15	78260762	unclassified	probably benign
R4649:Ncf4	UTSW	15	78255989	missense	possibly damaging	0.61
R4905:Ncf4	UTSW	15	78254904	missense	probably damaging	0.99
R5114:Ncf4	UTSW	15	78262393	unclassified	probably benign
R5531:Ncf4	UTSW	15	78260788	unclassified	probably benign
R5799:Ncf4	UTSW	15	78250977	missense	probably benign	0.00
R7284:Ncf4	UTSW	15	78260702	missense	probably benign	0.01
R8193:Ncf4	UTSW	15	78262266	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCGGTTGGAAAGTATCTCGGTGAC -3'
(R):5'- ACCGTGACTTTTGTGACCCAGCTC -3'

Sequencing Primer
(F):5'- GAAAGTATCTCGGTGACACTTG -3'
(R):5'- GGCCTTTCAGGATTGAAGATG -3'

Posted On

2013-05-09