Incidental Mutation 'R0409:Rev1'
ID36494
Institutional Source Beutler Lab
Gene Symbol Rev1
Ensembl Gene ENSMUSG00000026082
Gene NameREV1, DNA directed polymerase
SynonymsREV1, Rev1l, 1110027I23Rik
MMRRC Submission 038611-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R0409 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location38052786-38129801 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 38074368 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 539 (Y539*)
Ref Sequence ENSEMBL: ENSMUSP00000027251 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027251]
PDB Structure
Solution structure of the mouse Rev1 C-terminal domain [SOLUTION NMR]
Solution structure of the mouse Rev1 CTD in complex with the Rev1-interacting Region (RIR)of Pol Kappa [SOLUTION NMR]
Structure of the Rev1 CTD-Rev3/7-Pol kappa RIR complex [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000027251
AA Change: Y539*
SMART Domains Protein: ENSMUSP00000027251
Gene: ENSMUSG00000026082
AA Change: Y539*

DomainStartEndE-ValueType
BRCT 46 121 3.99e-13 SMART
low complexity region 320 342 N/A INTRINSIC
Pfam:IMS 420 620 1.9e-43 PFAM
Pfam:IMS_C 700 831 5.8e-20 PFAM
low complexity region 888 901 N/A INTRINSIC
Pfam:DUF4414 938 1071 9.7e-11 PFAM
Pfam:REV1_C 1127 1248 1.2e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192697
Predicted Effect probably benign
Transcript: ENSMUST00000193472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194650
Predicted Effect probably benign
Transcript: ENSMUST00000194815
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195028
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to the S. cerevisiae mutagenesis protein Rev1. The Rev1 proteins contain a BRCT domain, which is important in protein-protein interactions. A suggested role for the human Rev1-like protein is as a scaffold that recruits DNA polymerases involved in translesion synthesis (TLS) of damaged DNA. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal somatic hypermutation frequency of the Ig gene. Mice homozygous for a knock-out allele exhibit background-sensitive prenatal lethality and abnormal somatic hypermutation frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A C 4: 42,972,203 K512T probably damaging Het
1700113H08Rik G T 10: 87,225,954 A89S probably damaging Het
4933417A18Rik A T 13: 34,924,549 I5L probably benign Het
Alkbh3 T A 2: 94,001,448 I146F possibly damaging Het
Aox2 A T 1: 58,336,624 I871F possibly damaging Het
Birc2 A C 9: 7,819,384 V509G possibly damaging Het
Car7 G A 8: 104,548,424 A165T probably damaging Het
Ccdc81 A G 7: 89,886,215 V271A probably benign Het
Cdc40 G T 10: 40,847,168 H302N probably damaging Het
Cep104 C T 4: 153,983,053 probably benign Het
Cfap54 C A 10: 92,776,213 S3161I probably benign Het
Chil5 A G 3: 106,034,966 probably benign Het
Chil6 C T 3: 106,404,176 G96D probably benign Het
Cnot1 T C 8: 95,748,855 K531E probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Disp3 T G 4: 148,271,959 E148A probably damaging Het
Eps8l2 A G 7: 141,342,980 Y52C probably damaging Het
Exph5 C A 9: 53,374,343 T908K probably benign Het
Fat4 C T 3: 38,977,413 S2449F probably damaging Het
Faxc T A 4: 21,948,751 N154K probably benign Het
Fbxo43 C T 15: 36,162,357 A235T probably benign Het
Fnip1 A G 11: 54,480,354 probably null Het
Fsd1l T C 4: 53,679,932 L210P probably benign Het
Gm6420 A C 1: 23,256,038 S123R unknown Het
Gm8801 T G 17: 35,947,376 noncoding transcript Het
Gmfb T C 14: 46,816,222 I36V probably benign Het
Gsap G A 5: 21,222,445 probably benign Het
Hectd1 T A 12: 51,782,556 I969L possibly damaging Het
Il21r G T 7: 125,629,840 probably benign Het
Lrrc7 A G 3: 158,161,426 F893L possibly damaging Het
Map2 A G 1: 66,433,580 I1715V probably damaging Het
Mlh3 A G 12: 85,240,854 I1339T possibly damaging Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Noc3l A G 19: 38,817,927 probably benign Het
Nup93 A G 8: 94,303,665 D384G probably damaging Het
Olfr1036 T A 2: 86,075,302 C187* probably null Het
Olfr474 T C 7: 107,955,226 I195T probably benign Het
Olfr889 C T 9: 38,116,251 L152F probably benign Het
Pls1 A T 9: 95,786,919 probably benign Het
Prkcb A T 7: 122,424,977 H75L probably damaging Het
Rnf10 A T 5: 115,255,447 probably benign Het
Rnpepl1 A G 1: 92,915,860 Y234C probably damaging Het
Sdk2 T C 11: 113,850,891 probably benign Het
Sec23b T A 2: 144,567,912 M240K probably benign Het
Sema5a A T 15: 32,681,609 N945Y probably damaging Het
Snapc4 C A 2: 26,367,216 R799L probably benign Het
Tctn3 T C 19: 40,611,416 probably benign Het
Tfpt G A 7: 3,620,899 Q50* probably null Het
Trim80 T C 11: 115,441,213 V77A probably damaging Het
Trp73 T A 4: 154,064,384 D256V possibly damaging Het
Utrn G T 10: 12,643,601 N2202K probably benign Het
Vps13c T A 9: 67,951,644 F2792Y probably benign Het
Other mutations in Rev1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Rev1 APN 1 38098940 missense probably damaging 1.00
IGL01065:Rev1 APN 1 38099009 missense possibly damaging 0.89
IGL01393:Rev1 APN 1 38092063 missense probably damaging 1.00
IGL03003:Rev1 APN 1 38088073 missense possibly damaging 0.77
H8562:Rev1 UTSW 1 38056767 missense probably damaging 0.96
PIT1430001:Rev1 UTSW 1 38056256 unclassified probably benign
R0606:Rev1 UTSW 1 38059123 missense probably null 1.00
R1134:Rev1 UTSW 1 38057687 missense probably benign 0.04
R1171:Rev1 UTSW 1 38088500 missense possibly damaging 0.89
R1208:Rev1 UTSW 1 38059118 unclassified probably benign
R1440:Rev1 UTSW 1 38088205 missense probably damaging 1.00
R1485:Rev1 UTSW 1 38088572 missense probably benign 0.00
R1627:Rev1 UTSW 1 38055490 missense probably damaging 0.99
R3845:Rev1 UTSW 1 38098988 missense probably damaging 0.99
R3948:Rev1 UTSW 1 38074333 missense possibly damaging 0.69
R4074:Rev1 UTSW 1 38054238 missense possibly damaging 0.50
R4075:Rev1 UTSW 1 38054238 missense possibly damaging 0.50
R4076:Rev1 UTSW 1 38054238 missense possibly damaging 0.50
R4248:Rev1 UTSW 1 38107648 missense possibly damaging 0.87
R4293:Rev1 UTSW 1 38108419 missense possibly damaging 0.89
R4548:Rev1 UTSW 1 38059194 missense possibly damaging 0.72
R4610:Rev1 UTSW 1 38053649 missense probably damaging 1.00
R4654:Rev1 UTSW 1 38079256 intron probably benign
R5032:Rev1 UTSW 1 38074489 intron probably benign
R5286:Rev1 UTSW 1 38055326 nonsense probably null
R5311:Rev1 UTSW 1 38079393 missense probably benign 0.00
R5327:Rev1 UTSW 1 38108451 nonsense probably null
R6363:Rev1 UTSW 1 38071489 missense probably damaging 1.00
R7050:Rev1 UTSW 1 38054271 missense probably damaging 1.00
R7072:Rev1 UTSW 1 38067545 nonsense probably null
R7132:Rev1 UTSW 1 38071449 missense possibly damaging 0.95
R7264:Rev1 UTSW 1 38085601 missense probably damaging 1.00
R7298:Rev1 UTSW 1 38053104 missense probably damaging 1.00
R7367:Rev1 UTSW 1 38074407 nonsense probably null
R7395:Rev1 UTSW 1 38088065 missense possibly damaging 0.69
R7829:Rev1 UTSW 1 38056445 missense probably damaging 0.98
R8053:Rev1 UTSW 1 38063141 missense not run
X0017:Rev1 UTSW 1 38053661 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTCAATCTGCCTCAGGGGAAAG -3'
(R):5'- AAAGGGGCCAGAGGTCAAGTTTTAC -3'

Sequencing Primer
(F):5'- GTCCGGTAGATCTCACAATATGC -3'
(R):5'- CCTATTGTTAACCCCTGATGAGAAGG -3'
Posted On2013-05-09