Incidental Mutation 'R0409:Colgalt2'
ID36497
Institutional Source Beutler Lab
Gene Symbol Colgalt2
Ensembl Gene ENSMUSG00000032649
Gene Namecollagen beta(1-O)galactosyltransferase 2
SynonymsGlt25d2
MMRRC Submission 038611-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R0409 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location152399830-152510695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 152508561 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 551 (A551S)
Ref Sequence ENSEMBL: ENSMUSP00000037532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044311] [ENSMUST00000127586]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044311
AA Change: A551S

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000037532
Gene: ENSMUSG00000032649
AA Change: A551S

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 61 181 1.3e-20 PFAM
Pfam:Glyco_transf_25 340 525 5.8e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127586
SMART Domains Protein: ENSMUSP00000119210
Gene: ENSMUSG00000032649

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Glyco_tranf_2_4 61 181 4.3e-17 PFAM
Pfam:Glyco_transf_25 340 466 3.2e-37 PFAM
Meta Mutation Damage Score 0.2340 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 100% (55/55)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A C 4: 42,972,203 K512T probably damaging Het
1700113H08Rik G T 10: 87,225,954 A89S probably damaging Het
4933417A18Rik A T 13: 34,924,549 I5L probably benign Het
Alkbh3 T A 2: 94,001,448 I146F possibly damaging Het
Aox2 A T 1: 58,336,624 I871F possibly damaging Het
Birc2 A C 9: 7,819,384 V509G possibly damaging Het
Car7 G A 8: 104,548,424 A165T probably damaging Het
Ccdc81 A G 7: 89,886,215 V271A probably benign Het
Cdc40 G T 10: 40,847,168 H302N probably damaging Het
Cep104 C T 4: 153,983,053 probably benign Het
Cfap54 C A 10: 92,776,213 S3161I probably benign Het
Chil5 A G 3: 106,034,966 probably benign Het
Chil6 C T 3: 106,404,176 G96D probably benign Het
Cnot1 T C 8: 95,748,855 K531E probably damaging Het
Disp3 T G 4: 148,271,959 E148A probably damaging Het
Eps8l2 A G 7: 141,342,980 Y52C probably damaging Het
Exph5 C A 9: 53,374,343 T908K probably benign Het
Fat4 C T 3: 38,977,413 S2449F probably damaging Het
Faxc T A 4: 21,948,751 N154K probably benign Het
Fbxo43 C T 15: 36,162,357 A235T probably benign Het
Fnip1 A G 11: 54,480,354 probably null Het
Fsd1l T C 4: 53,679,932 L210P probably benign Het
Gm6420 A C 1: 23,256,038 S123R unknown Het
Gm8801 T G 17: 35,947,376 noncoding transcript Het
Gmfb T C 14: 46,816,222 I36V probably benign Het
Gsap G A 5: 21,222,445 probably benign Het
Hectd1 T A 12: 51,782,556 I969L possibly damaging Het
Il21r G T 7: 125,629,840 probably benign Het
Lrrc7 A G 3: 158,161,426 F893L possibly damaging Het
Map2 A G 1: 66,433,580 I1715V probably damaging Het
Mlh3 A G 12: 85,240,854 I1339T possibly damaging Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Noc3l A G 19: 38,817,927 probably benign Het
Nup93 A G 8: 94,303,665 D384G probably damaging Het
Olfr1036 T A 2: 86,075,302 C187* probably null Het
Olfr474 T C 7: 107,955,226 I195T probably benign Het
Olfr889 C T 9: 38,116,251 L152F probably benign Het
Pls1 A T 9: 95,786,919 probably benign Het
Prkcb A T 7: 122,424,977 H75L probably damaging Het
Rev1 A T 1: 38,074,368 Y539* probably null Het
Rnf10 A T 5: 115,255,447 probably benign Het
Rnpepl1 A G 1: 92,915,860 Y234C probably damaging Het
Sdk2 T C 11: 113,850,891 probably benign Het
Sec23b T A 2: 144,567,912 M240K probably benign Het
Sema5a A T 15: 32,681,609 N945Y probably damaging Het
Snapc4 C A 2: 26,367,216 R799L probably benign Het
Tctn3 T C 19: 40,611,416 probably benign Het
Tfpt G A 7: 3,620,899 Q50* probably null Het
Trim80 T C 11: 115,441,213 V77A probably damaging Het
Trp73 T A 4: 154,064,384 D256V possibly damaging Het
Utrn G T 10: 12,643,601 N2202K probably benign Het
Vps13c T A 9: 67,951,644 F2792Y probably benign Het
Other mutations in Colgalt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Colgalt2 APN 1 152506878 missense probably damaging 0.98
IGL02900:Colgalt2 APN 1 152508730 missense probably damaging 0.99
R0280:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0282:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0328:Colgalt2 UTSW 1 152473108 missense probably damaging 1.00
R0412:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0485:Colgalt2 UTSW 1 152484871 missense probably damaging 1.00
R0518:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0519:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0556:Colgalt2 UTSW 1 152471813 splice site probably benign
R0605:Colgalt2 UTSW 1 152495792 splice site probably benign
R0628:Colgalt2 UTSW 1 152508561 missense possibly damaging 0.68
R0972:Colgalt2 UTSW 1 152471744 missense probably damaging 1.00
R1170:Colgalt2 UTSW 1 152503017 missense probably damaging 1.00
R1373:Colgalt2 UTSW 1 152473161 missense probably damaging 1.00
R1452:Colgalt2 UTSW 1 152504153 missense probably damaging 1.00
R1456:Colgalt2 UTSW 1 152484904 missense probably damaging 1.00
R1544:Colgalt2 UTSW 1 152484952 missense probably damaging 1.00
R1707:Colgalt2 UTSW 1 152400363 missense probably damaging 1.00
R2285:Colgalt2 UTSW 1 152468550 missense probably benign 0.00
R2917:Colgalt2 UTSW 1 152471744 missense probably damaging 1.00
R3916:Colgalt2 UTSW 1 152508611 nonsense probably null
R3917:Colgalt2 UTSW 1 152508611 nonsense probably null
R4250:Colgalt2 UTSW 1 152489887 missense probably benign 0.00
R4282:Colgalt2 UTSW 1 152468531 missense probably damaging 1.00
R4421:Colgalt2 UTSW 1 152485012 missense probably damaging 0.99
R4583:Colgalt2 UTSW 1 152506876 missense probably damaging 1.00
R4743:Colgalt2 UTSW 1 152400343 missense probably damaging 0.97
R4751:Colgalt2 UTSW 1 152489876 missense probably benign 0.34
R4832:Colgalt2 UTSW 1 152484998 missense possibly damaging 0.87
R4930:Colgalt2 UTSW 1 152499959 missense possibly damaging 0.92
R5319:Colgalt2 UTSW 1 152484869 missense possibly damaging 0.78
R5504:Colgalt2 UTSW 1 152400303 missense possibly damaging 0.88
R5916:Colgalt2 UTSW 1 152504122 missense probably damaging 1.00
R6006:Colgalt2 UTSW 1 152473161 missense probably damaging 1.00
R6362:Colgalt2 UTSW 1 152471798 missense probably damaging 1.00
R6837:Colgalt2 UTSW 1 152506828 missense probably damaging 1.00
R7464:Colgalt2 UTSW 1 152504144 missense probably damaging 0.97
R8462:Colgalt2 UTSW 1 152503072 missense probably damaging 1.00
R8725:Colgalt2 UTSW 1 152484911 missense probably damaging 0.99
R8727:Colgalt2 UTSW 1 152484911 missense probably damaging 0.99
X0028:Colgalt2 UTSW 1 152471720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTACCCAGGCAGTTTCAGAGATGAC -3'
(R):5'- CAGACAGTGATGAACCTTGCAGACC -3'

Sequencing Primer
(F):5'- CAGTTTCAGAGATGACAAGCAG -3'
(R):5'- TCTTGAAGGCACAGTGTCCAG -3'
Posted On2013-05-09