Incidental Mutation 'R0409:Alkbh3'
ID36500
Institutional Source Beutler Lab
Gene Symbol Alkbh3
Ensembl Gene ENSMUSG00000040174
Gene NamealkB homolog 3, alpha-ketoglutarate-dependent dioxygenase
SynonymsmABH3, 1700108H04Rik, 1810020C19Rik, Abh3
MMRRC Submission 038611-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R0409 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location93980550-94010807 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94001448 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 146 (I146F)
Ref Sequence ENSEMBL: ENSMUSP00000038721 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040005] [ENSMUST00000111240] [ENSMUST00000126378]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040005
AA Change: I146F

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038721
Gene: ENSMUSG00000040174
AA Change: I146F

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 89 275 2e-34 PFAM
Pfam:2OG-FeII_Oxy 172 277 2.1e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111240
AA Change: I147F

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106871
Gene: ENSMUSG00000040174
AA Change: I147F

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 90 276 3.6e-32 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000126378
AA Change: I147F

PolyPhen 2 Score 0.681 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000122043
Gene: ENSMUSG00000040174
AA Change: I147F

DomainStartEndE-ValueType
Pfam:2OG-FeII_Oxy_2 90 202 8.9e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138046
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138107
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156763
Meta Mutation Damage Score 0.1146 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Escherichia coli AlkB protein protects against the cytotoxicity of methylating agents by repair of the specific DNA lesions generated in single-stranded DNA. ALKBH2 (MIM 610602) and ALKBH3 are E. coli AlkB homologs that catalyze the removal of 1-methyladenine and 3-methylcytosine (Duncan et al., 2002 [PubMed 12486230]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a normal lifespan and are phenotypically indistinguishable from control littermates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A C 4: 42,972,203 K512T probably damaging Het
1700113H08Rik G T 10: 87,225,954 A89S probably damaging Het
4933417A18Rik A T 13: 34,924,549 I5L probably benign Het
Aox2 A T 1: 58,336,624 I871F possibly damaging Het
Birc2 A C 9: 7,819,384 V509G possibly damaging Het
Car7 G A 8: 104,548,424 A165T probably damaging Het
Ccdc81 A G 7: 89,886,215 V271A probably benign Het
Cdc40 G T 10: 40,847,168 H302N probably damaging Het
Cep104 C T 4: 153,983,053 probably benign Het
Cfap54 C A 10: 92,776,213 S3161I probably benign Het
Chil5 A G 3: 106,034,966 probably benign Het
Chil6 C T 3: 106,404,176 G96D probably benign Het
Cnot1 T C 8: 95,748,855 K531E probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Disp3 T G 4: 148,271,959 E148A probably damaging Het
Eps8l2 A G 7: 141,342,980 Y52C probably damaging Het
Exph5 C A 9: 53,374,343 T908K probably benign Het
Fat4 C T 3: 38,977,413 S2449F probably damaging Het
Faxc T A 4: 21,948,751 N154K probably benign Het
Fbxo43 C T 15: 36,162,357 A235T probably benign Het
Fnip1 A G 11: 54,480,354 probably null Het
Fsd1l T C 4: 53,679,932 L210P probably benign Het
Gm6420 A C 1: 23,256,038 S123R unknown Het
Gm8801 T G 17: 35,947,376 noncoding transcript Het
Gmfb T C 14: 46,816,222 I36V probably benign Het
Gsap G A 5: 21,222,445 probably benign Het
Hectd1 T A 12: 51,782,556 I969L possibly damaging Het
Il21r G T 7: 125,629,840 probably benign Het
Lrrc7 A G 3: 158,161,426 F893L possibly damaging Het
Map2 A G 1: 66,433,580 I1715V probably damaging Het
Mlh3 A G 12: 85,240,854 I1339T possibly damaging Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Noc3l A G 19: 38,817,927 probably benign Het
Nup93 A G 8: 94,303,665 D384G probably damaging Het
Olfr1036 T A 2: 86,075,302 C187* probably null Het
Olfr474 T C 7: 107,955,226 I195T probably benign Het
Olfr889 C T 9: 38,116,251 L152F probably benign Het
Pls1 A T 9: 95,786,919 probably benign Het
Prkcb A T 7: 122,424,977 H75L probably damaging Het
Rev1 A T 1: 38,074,368 Y539* probably null Het
Rnf10 A T 5: 115,255,447 probably benign Het
Rnpepl1 A G 1: 92,915,860 Y234C probably damaging Het
Sdk2 T C 11: 113,850,891 probably benign Het
Sec23b T A 2: 144,567,912 M240K probably benign Het
Sema5a A T 15: 32,681,609 N945Y probably damaging Het
Snapc4 C A 2: 26,367,216 R799L probably benign Het
Tctn3 T C 19: 40,611,416 probably benign Het
Tfpt G A 7: 3,620,899 Q50* probably null Het
Trim80 T C 11: 115,441,213 V77A probably damaging Het
Trp73 T A 4: 154,064,384 D256V possibly damaging Het
Utrn G T 10: 12,643,601 N2202K probably benign Het
Vps13c T A 9: 67,951,644 F2792Y probably benign Het
Other mutations in Alkbh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01363:Alkbh3 APN 2 94003051 critical splice donor site probably null
IGL01940:Alkbh3 APN 2 93981595 missense probably damaging 0.98
IGL02554:Alkbh3 APN 2 93996347 missense probably damaging 1.00
IGL02638:Alkbh3 APN 2 94008113 missense probably benign 0.02
IGL02640:Alkbh3 APN 2 93996361 missense possibly damaging 0.90
R0437:Alkbh3 UTSW 2 93981569 missense probably damaging 1.00
R1456:Alkbh3 UTSW 2 94001419 splice site probably null
R1592:Alkbh3 UTSW 2 94008424 intron probably null
R2359:Alkbh3 UTSW 2 94008113 missense probably benign 0.01
R3109:Alkbh3 UTSW 2 94004763 missense probably damaging 1.00
R4297:Alkbh3 UTSW 2 94008124 missense probably benign
R5562:Alkbh3 UTSW 2 93996379 unclassified probably null
R6216:Alkbh3 UTSW 2 94008536 start gained probably benign
R7088:Alkbh3 UTSW 2 94004752 missense possibly damaging 0.55
R7711:Alkbh3 UTSW 2 94008092 missense probably benign
R8014:Alkbh3 UTSW 2 94001513 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGCCCAGTTCACTGTTTCAGTTTG -3'
(R):5'- TGAGGTCCACTCCCCATAATCTGC -3'

Sequencing Primer
(F):5'- AGTTTGCTCCCATCCTCCAAG -3'
(R):5'- CCCATTTCCTGTCTGAGGAAGG -3'
Posted On2013-05-09