Incidental Mutation 'R0409:Il21r'
ID36516
Institutional Source Beutler Lab
Gene Symbol Il21r
Ensembl Gene ENSMUSG00000030745
Gene Nameinterleukin 21 receptor
SynonymsNILR
MMRRC Submission 038611-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R0409 (G1)
Quality Score152
Status Validated
Chromosome7
Chromosomal Location125603429-125633570 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 125629840 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033000] [ENSMUST00000206103] [ENSMUST00000206234]
Predicted Effect probably benign
Transcript: ENSMUST00000033000
SMART Domains Protein: ENSMUSP00000033000
Gene: ENSMUSG00000030745

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
FN3 120 209 3.4e0 SMART
low complexity region 239 250 N/A INTRINSIC
low complexity region 307 312 N/A INTRINSIC
low complexity region 424 450 N/A INTRINSIC
low complexity region 466 481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206103
Predicted Effect probably benign
Transcript: ENSMUST00000206234
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor for interleukin 21 (IL21). It belongs to the type I cytokine receptors, and has been shown to form a heterodimeric receptor complex with the common gamma-chain, a receptor subunit also shared by the receptors for interleukin 2, 4, 7, 9, and 15. This receptor transduces the growth promoting signal of IL21, and is important for the proliferation and differentiation of T cells, B cells, and natural killer (NK) cells. The ligand binding of this receptor leads to the activation of multiple downstream signaling molecules, including JAK1, JAK3, STAT1, and STAT3. Knockout studies of a similar gene in mouse suggest a role for this gene in regulating immunoglobulin production. Three alternatively spliced transcript variants have been described. [provided by RefSeq, Jul 2010]
PHENOTYPE: Homozygous null mutation of this gene results in decreased immunoglobulin levels, decreased Th17 T cell differentation, and decreased production of IL-17. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A C 4: 42,972,203 K512T probably damaging Het
1700113H08Rik G T 10: 87,225,954 A89S probably damaging Het
4933417A18Rik A T 13: 34,924,549 I5L probably benign Het
Alkbh3 T A 2: 94,001,448 I146F possibly damaging Het
Aox2 A T 1: 58,336,624 I871F possibly damaging Het
Birc2 A C 9: 7,819,384 V509G possibly damaging Het
Car7 G A 8: 104,548,424 A165T probably damaging Het
Ccdc81 A G 7: 89,886,215 V271A probably benign Het
Cdc40 G T 10: 40,847,168 H302N probably damaging Het
Cep104 C T 4: 153,983,053 probably benign Het
Cfap54 C A 10: 92,776,213 S3161I probably benign Het
Chil5 A G 3: 106,034,966 probably benign Het
Chil6 C T 3: 106,404,176 G96D probably benign Het
Cnot1 T C 8: 95,748,855 K531E probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Disp3 T G 4: 148,271,959 E148A probably damaging Het
Eps8l2 A G 7: 141,342,980 Y52C probably damaging Het
Exph5 C A 9: 53,374,343 T908K probably benign Het
Fat4 C T 3: 38,977,413 S2449F probably damaging Het
Faxc T A 4: 21,948,751 N154K probably benign Het
Fbxo43 C T 15: 36,162,357 A235T probably benign Het
Fnip1 A G 11: 54,480,354 probably null Het
Fsd1l T C 4: 53,679,932 L210P probably benign Het
Gm6420 A C 1: 23,256,038 S123R unknown Het
Gm8801 T G 17: 35,947,376 noncoding transcript Het
Gmfb T C 14: 46,816,222 I36V probably benign Het
Gsap G A 5: 21,222,445 probably benign Het
Hectd1 T A 12: 51,782,556 I969L possibly damaging Het
Lrrc7 A G 3: 158,161,426 F893L possibly damaging Het
Map2 A G 1: 66,433,580 I1715V probably damaging Het
Mlh3 A G 12: 85,240,854 I1339T possibly damaging Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Noc3l A G 19: 38,817,927 probably benign Het
Nup93 A G 8: 94,303,665 D384G probably damaging Het
Olfr1036 T A 2: 86,075,302 C187* probably null Het
Olfr474 T C 7: 107,955,226 I195T probably benign Het
Olfr889 C T 9: 38,116,251 L152F probably benign Het
Pls1 A T 9: 95,786,919 probably benign Het
Prkcb A T 7: 122,424,977 H75L probably damaging Het
Rev1 A T 1: 38,074,368 Y539* probably null Het
Rnf10 A T 5: 115,255,447 probably benign Het
Rnpepl1 A G 1: 92,915,860 Y234C probably damaging Het
Sdk2 T C 11: 113,850,891 probably benign Het
Sec23b T A 2: 144,567,912 M240K probably benign Het
Sema5a A T 15: 32,681,609 N945Y probably damaging Het
Snapc4 C A 2: 26,367,216 R799L probably benign Het
Tctn3 T C 19: 40,611,416 probably benign Het
Tfpt G A 7: 3,620,899 Q50* probably null Het
Trim80 T C 11: 115,441,213 V77A probably damaging Het
Trp73 T A 4: 154,064,384 D256V possibly damaging Het
Utrn G T 10: 12,643,601 N2202K probably benign Het
Vps13c T A 9: 67,951,644 F2792Y probably benign Het
Other mutations in Il21r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Il21r APN 7 125632525 missense probably damaging 1.00
bellflower UTSW 7 125628043 critical splice acceptor site probably null
R0573:Il21r UTSW 7 125625285 missense probably benign 0.06
R0635:Il21r UTSW 7 125632506 missense probably damaging 1.00
R1933:Il21r UTSW 7 125628981 missense possibly damaging 0.92
R1969:Il21r UTSW 7 125628972 missense probably damaging 0.99
R3716:Il21r UTSW 7 125632269 missense probably damaging 0.96
R3968:Il21r UTSW 7 125628043 critical splice acceptor site probably null
R4546:Il21r UTSW 7 125628899 missense probably damaging 1.00
R5086:Il21r UTSW 7 125632855 missense probably damaging 0.99
R5566:Il21r UTSW 7 125625298 missense probably damaging 1.00
R5988:Il21r UTSW 7 125632288 missense probably damaging 0.99
R6234:Il21r UTSW 7 125632585 missense probably damaging 1.00
R6259:Il21r UTSW 7 125630719 missense possibly damaging 0.65
R6896:Il21r UTSW 7 125626956 missense probably damaging 1.00
R7162:Il21r UTSW 7 125632311 missense probably benign 0.00
R7263:Il21r UTSW 7 125632905 missense probably benign 0.04
R7740:Il21r UTSW 7 125632555 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGGGATCAGAACCCAGCTTCCTTC -3'
(R):5'- GTGTGCCAAGTTTACAGGGTAGCC -3'

Sequencing Primer
(F):5'- CCAGCTTCCTTCCAGCC -3'
(R):5'- CATGGACCTGGGGTGGAAG -3'
Posted On2013-05-09