Incidental Mutation 'R0409:Cnot1'
ID 36518
Institutional Source Beutler Lab
Gene Symbol Cnot1
Ensembl Gene ENSMUSG00000036550
Gene Name CCR4-NOT transcription complex, subunit 1
Synonyms 6030411K04Rik
MMRRC Submission 038611-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0409 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 95719451-95807464 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 95748855 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 531 (K531E)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068452] [ENSMUST00000098473] [ENSMUST00000211887] [ENSMUST00000213006] [ENSMUST00000213046]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000068452
AA Change: K1059E

PolyPhen 2 Score 0.425 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000063565
Gene: ENSMUSG00000036550
AA Change: K1059E

low complexity region 181 189 N/A INTRINSIC
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
PDB:4J8S|A 798 999 1e-137 PDB
low complexity region 1011 1028 N/A INTRINSIC
low complexity region 1031 1055 N/A INTRINSIC
PDB:4CT4|C 1056 1295 1e-148 PDB
low complexity region 1296 1308 N/A INTRINSIC
low complexity region 1328 1345 N/A INTRINSIC
Pfam:DUF3819 1381 1530 2.5e-56 PFAM
low complexity region 1634 1648 N/A INTRINSIC
Pfam:Not1 1991 2305 2.4e-125 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083155
Predicted Effect possibly damaging
Transcript: ENSMUST00000098473
AA Change: K1064E

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096073
Gene: ENSMUSG00000036550
AA Change: K1064E

low complexity region 181 189 N/A INTRINSIC
Pfam:CNOT1_HEAT 500 656 2.4e-57 PFAM
low complexity region 687 698 N/A INTRINSIC
low complexity region 779 796 N/A INTRINSIC
Pfam:CNOT1_TTP_bind 812 1004 1.4e-87 PFAM
low complexity region 1016 1033 N/A INTRINSIC
low complexity region 1036 1060 N/A INTRINSIC
Pfam:CNOT1_CAF1_bind 1087 1313 5.7e-99 PFAM
low complexity region 1333 1350 N/A INTRINSIC
Pfam:DUF3819 1387 1534 2.3e-57 PFAM
low complexity region 1639 1653 N/A INTRINSIC
Pfam:Not1 1998 2357 5.7e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197815
Predicted Effect probably benign
Transcript: ENSMUST00000211887
AA Change: K1057E

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably damaging
Transcript: ENSMUST00000211973
AA Change: K531E

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213006
AA Change: K1064E

PolyPhen 2 Score 0.646 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000213046
Meta Mutation Damage Score 0.1399 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 100% (55/55)
MGI Phenotype PHENOTYPE: Mice hmozygous for a conditional allele activated in cardiomyocytes exhibit postnatal lethality, decreased cardiac muscle contractility, prolonged QT interval and cardiac muscle cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A C 4: 42,972,203 K512T probably damaging Het
1700113H08Rik G T 10: 87,225,954 A89S probably damaging Het
4933417A18Rik A T 13: 34,924,549 I5L probably benign Het
Alkbh3 T A 2: 94,001,448 I146F possibly damaging Het
Aox2 A T 1: 58,336,624 I871F possibly damaging Het
Birc2 A C 9: 7,819,384 V509G possibly damaging Het
Car7 G A 8: 104,548,424 A165T probably damaging Het
Ccdc81 A G 7: 89,886,215 V271A probably benign Het
Cdc40 G T 10: 40,847,168 H302N probably damaging Het
Cep104 C T 4: 153,983,053 probably benign Het
Cfap54 C A 10: 92,776,213 S3161I probably benign Het
Chil5 A G 3: 106,034,966 probably benign Het
Chil6 C T 3: 106,404,176 G96D probably benign Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Disp3 T G 4: 148,271,959 E148A probably damaging Het
Eps8l2 A G 7: 141,342,980 Y52C probably damaging Het
Exph5 C A 9: 53,374,343 T908K probably benign Het
Fat4 C T 3: 38,977,413 S2449F probably damaging Het
Faxc T A 4: 21,948,751 N154K probably benign Het
Fbxo43 C T 15: 36,162,357 A235T probably benign Het
Fnip1 A G 11: 54,480,354 probably null Het
Fsd1l T C 4: 53,679,932 L210P probably benign Het
Gm6420 A C 1: 23,256,038 S123R unknown Het
Gm8801 T G 17: 35,947,376 noncoding transcript Het
Gmfb T C 14: 46,816,222 I36V probably benign Het
Gsap G A 5: 21,222,445 probably benign Het
Hectd1 T A 12: 51,782,556 I969L possibly damaging Het
Il21r G T 7: 125,629,840 probably benign Het
Lrrc7 A G 3: 158,161,426 F893L possibly damaging Het
Map2 A G 1: 66,433,580 I1715V probably damaging Het
Mlh3 A G 12: 85,240,854 I1339T possibly damaging Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Noc3l A G 19: 38,817,927 probably benign Het
Nup93 A G 8: 94,303,665 D384G probably damaging Het
Olfr1036 T A 2: 86,075,302 C187* probably null Het
Olfr474 T C 7: 107,955,226 I195T probably benign Het
Olfr889 C T 9: 38,116,251 L152F probably benign Het
Pls1 A T 9: 95,786,919 probably benign Het
Prkcb A T 7: 122,424,977 H75L probably damaging Het
Rev1 A T 1: 38,074,368 Y539* probably null Het
Rnf10 A T 5: 115,255,447 probably benign Het
Rnpepl1 A G 1: 92,915,860 Y234C probably damaging Het
Sdk2 T C 11: 113,850,891 probably benign Het
Sec23b T A 2: 144,567,912 M240K probably benign Het
Sema5a A T 15: 32,681,609 N945Y probably damaging Het
Snapc4 C A 2: 26,367,216 R799L probably benign Het
Tctn3 T C 19: 40,611,416 probably benign Het
Tfpt G A 7: 3,620,899 Q50* probably null Het
Trim80 T C 11: 115,441,213 V77A probably damaging Het
Trp73 T A 4: 154,064,384 D256V possibly damaging Het
Utrn G T 10: 12,643,601 N2202K probably benign Het
Vps13c T A 9: 67,951,644 F2792Y probably benign Het
Other mutations in Cnot1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cnot1 APN 8 95726079 missense probably damaging 1.00
IGL01340:Cnot1 APN 8 95760537 missense probably damaging 1.00
IGL01457:Cnot1 APN 8 95741009 missense probably damaging 1.00
IGL01505:Cnot1 APN 8 95728718 missense probably damaging 0.98
IGL02401:Cnot1 APN 8 95756133 missense possibly damaging 0.95
IGL02693:Cnot1 APN 8 95773485 missense probably damaging 1.00
IGL02696:Cnot1 APN 8 95745017 missense probably benign 0.00
IGL02754:Cnot1 APN 8 95755078 missense probably benign 0.03
IGL03092:Cnot1 APN 8 95769615 intron probably benign
IGL03174:Cnot1 APN 8 95761355 missense probably damaging 1.00
IGL03310:Cnot1 APN 8 95735680 splice site probably benign
IGL03371:Cnot1 APN 8 95774716 missense possibly damaging 0.85
Affiliate UTSW 8 95765125 missense probably damaging 0.99
Barge UTSW 8 95734129 missense probably benign 0.13
Byproduct UTSW 8 95745647 frame shift probably null
Chairman UTSW 8 95765027 missense possibly damaging 0.95
cohort UTSW 8 95735749 missense probably damaging 0.99
Director UTSW 8 95765062 missense probably benign 0.15
kowloon UTSW 8 95788658 missense probably damaging 1.00
tugboat UTSW 8 95773618 missense probably damaging 0.99
Xiao UTSW 8 95730420 missense probably damaging 1.00
BB001:Cnot1 UTSW 8 95745647 frame shift probably null
BB003:Cnot1 UTSW 8 95745647 frame shift probably null
BB011:Cnot1 UTSW 8 95745647 frame shift probably null
BB013:Cnot1 UTSW 8 95745647 frame shift probably null
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0008:Cnot1 UTSW 8 95761341 missense probably damaging 1.00
R0091:Cnot1 UTSW 8 95763144 missense probably damaging 1.00
R0335:Cnot1 UTSW 8 95772000 missense probably benign 0.02
R0445:Cnot1 UTSW 8 95760208 missense probably damaging 1.00
R1505:Cnot1 UTSW 8 95728667 missense probably damaging 1.00
R1517:Cnot1 UTSW 8 95743213 missense probably benign 0.38
R1640:Cnot1 UTSW 8 95769832 missense probably damaging 0.98
R1737:Cnot1 UTSW 8 95748276 missense probably damaging 0.98
R1755:Cnot1 UTSW 8 95724577 missense probably damaging 1.00
R1901:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1902:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1903:Cnot1 UTSW 8 95743121 missense possibly damaging 0.50
R1988:Cnot1 UTSW 8 95741944 missense possibly damaging 0.89
R2051:Cnot1 UTSW 8 95724593 missense possibly damaging 0.47
R2054:Cnot1 UTSW 8 95739841 missense possibly damaging 0.55
R2072:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2074:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2075:Cnot1 UTSW 8 95739833 missense possibly damaging 0.89
R2093:Cnot1 UTSW 8 95775358 missense probably damaging 1.00
R2116:Cnot1 UTSW 8 95726153 missense probably damaging 1.00
R2191:Cnot1 UTSW 8 95761426 missense probably damaging 0.98
R2238:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2239:Cnot1 UTSW 8 95769521 missense probably benign 0.04
R2251:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2252:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2253:Cnot1 UTSW 8 95763186 missense probably benign 0.00
R2315:Cnot1 UTSW 8 95749062 missense probably damaging 1.00
R2431:Cnot1 UTSW 8 95774652 missense probably damaging 1.00
R2988:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R2989:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3108:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3109:Cnot1 UTSW 8 95735749 missense probably damaging 0.99
R3114:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3115:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3153:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R3154:Cnot1 UTSW 8 95744278 missense possibly damaging 0.80
R4112:Cnot1 UTSW 8 95773618 missense probably damaging 0.99
R4359:Cnot1 UTSW 8 95739848 missense probably damaging 1.00
R4382:Cnot1 UTSW 8 95769779 missense probably damaging 0.97
R4747:Cnot1 UTSW 8 95774682 missense probably benign 0.27
R4910:Cnot1 UTSW 8 95733231 missense probably benign 0.43
R4913:Cnot1 UTSW 8 95763067 missense possibly damaging 0.63
R4971:Cnot1 UTSW 8 95721626 missense probably damaging 1.00
R5056:Cnot1 UTSW 8 95741008 missense probably damaging 1.00
R5092:Cnot1 UTSW 8 95752768 missense possibly damaging 0.91
R5101:Cnot1 UTSW 8 95760187 missense possibly damaging 0.90
R5498:Cnot1 UTSW 8 95757355 missense possibly damaging 0.92
R5719:Cnot1 UTSW 8 95744296 missense possibly damaging 0.92
R5850:Cnot1 UTSW 8 95734147 nonsense probably null
R5956:Cnot1 UTSW 8 95754978 critical splice donor site probably null
R5981:Cnot1 UTSW 8 95788665 missense probably damaging 1.00
R6093:Cnot1 UTSW 8 95748894 missense probably benign 0.03
R6108:Cnot1 UTSW 8 95730420 missense probably damaging 1.00
R6261:Cnot1 UTSW 8 95741921 missense probably benign 0.00
R6632:Cnot1 UTSW 8 95773267 intron probably benign
R6882:Cnot1 UTSW 8 95720426 missense possibly damaging 0.85
R6966:Cnot1 UTSW 8 95724532 missense probably damaging 1.00
R6985:Cnot1 UTSW 8 95734129 missense probably benign 0.13
R7210:Cnot1 UTSW 8 95788658 missense probably damaging 1.00
R7410:Cnot1 UTSW 8 95733159 missense possibly damaging 0.77
R7623:Cnot1 UTSW 8 95727648 missense probably damaging 1.00
R7624:Cnot1 UTSW 8 95751819 missense probably damaging 1.00
R7695:Cnot1 UTSW 8 95770632 missense probably benign 0.03
R7703:Cnot1 UTSW 8 95760098 critical splice donor site probably null
R7771:Cnot1 UTSW 8 95765125 missense probably damaging 0.99
R7800:Cnot1 UTSW 8 95765062 missense probably benign 0.15
R7809:Cnot1 UTSW 8 95751778 missense probably damaging 1.00
R7857:Cnot1 UTSW 8 95745647 frame shift probably null
R7914:Cnot1 UTSW 8 95745647 frame shift probably null
R7924:Cnot1 UTSW 8 95745647 frame shift probably null
R7926:Cnot1 UTSW 8 95745647 frame shift probably null
R7981:Cnot1 UTSW 8 95763169 missense probably damaging 1.00
R8004:Cnot1 UTSW 8 95752752 missense probably benign 0.03
R8061:Cnot1 UTSW 8 95765027 missense possibly damaging 0.95
R8185:Cnot1 UTSW 8 95761351 missense probably damaging 1.00
R8269:Cnot1 UTSW 8 95751761 missense probably damaging 1.00
R8306:Cnot1 UTSW 8 95747021 missense probably benign 0.05
R8322:Cnot1 UTSW 8 95769844 missense probably benign 0.00
R8427:Cnot1 UTSW 8 95734324 missense probably benign 0.01
R8723:Cnot1 UTSW 8 95736279 missense probably benign 0.00
R8934:Cnot1 UTSW 8 95765067 missense probably benign 0.04
R9025:Cnot1 UTSW 8 95749032 missense probably benign
R9280:Cnot1 UTSW 8 95770599 missense probably benign 0.15
R9285:Cnot1 UTSW 8 95726118 missense probably damaging 1.00
R9299:Cnot1 UTSW 8 95741820 missense probably damaging 1.00
R9337:Cnot1 UTSW 8 95741820 missense probably damaging 1.00
X0050:Cnot1 UTSW 8 95743098 splice site probably null
Z1176:Cnot1 UTSW 8 95748277 missense possibly damaging 0.73
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cacctctgacctccatacac -3'
(R):5'- ctcaggcccaggctcag -3'
Posted On 2013-05-09