Incidental Mutation 'R0409:Fnip1'
ID36531
Institutional Source Beutler Lab
Gene Symbol Fnip1
Ensembl Gene ENSMUSG00000035992
Gene Namefolliculin interacting protein 1
SynonymsA730024A03Rik
MMRRC Submission 038611-MU
Accession Numbers

Ncbi RefSeq: NM_173753.4; MGI:2444668

Is this an essential gene? Probably essential (E-score: 0.760) question?
Stock #R0409 (G1)
Quality Score210
Status Not validated
Chromosome11
Chromosomal Location54438199-54518235 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 54480354 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046835] [ENSMUST00000143650]
Predicted Effect probably null
Transcript: ENSMUST00000046835
SMART Domains Protein: ENSMUSP00000049026
Gene: ENSMUSG00000035992

DomainStartEndE-ValueType
Pfam:FNIP_N 41 159 1.7e-29 PFAM
Pfam:FNIP_M 316 549 9.9e-92 PFAM
Pfam:FNIP_C 975 1161 7.6e-73 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000143650
SMART Domains Protein: ENSMUSP00000121399
Gene: ENSMUSG00000035992

DomainStartEndE-ValueType
Pfam:FNIP_N 17 139 3.9e-36 PFAM
Pfam:FNIP_M 288 526 5.1e-87 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 100% (55/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 2, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit arrested B cell development at the pre-B cell stage with increased B cell apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(1) Gene trapped(2)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik A C 4: 42,972,203 K512T probably damaging Het
1700113H08Rik G T 10: 87,225,954 A89S probably damaging Het
4933417A18Rik A T 13: 34,924,549 I5L probably benign Het
Alkbh3 T A 2: 94,001,448 I146F possibly damaging Het
Aox2 A T 1: 58,336,624 I871F possibly damaging Het
Birc2 A C 9: 7,819,384 V509G possibly damaging Het
Car7 G A 8: 104,548,424 A165T probably damaging Het
Ccdc81 A G 7: 89,886,215 V271A probably benign Het
Cdc40 G T 10: 40,847,168 H302N probably damaging Het
Cep104 C T 4: 153,983,053 probably benign Het
Cfap54 C A 10: 92,776,213 S3161I probably benign Het
Chil5 A G 3: 106,034,966 probably benign Het
Chil6 C T 3: 106,404,176 G96D probably benign Het
Cnot1 T C 8: 95,748,855 K531E probably damaging Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Disp3 T G 4: 148,271,959 E148A probably damaging Het
Eps8l2 A G 7: 141,342,980 Y52C probably damaging Het
Exph5 C A 9: 53,374,343 T908K probably benign Het
Fat4 C T 3: 38,977,413 S2449F probably damaging Het
Faxc T A 4: 21,948,751 N154K probably benign Het
Fbxo43 C T 15: 36,162,357 A235T probably benign Het
Fsd1l T C 4: 53,679,932 L210P probably benign Het
Gm6420 A C 1: 23,256,038 S123R unknown Het
Gm8801 T G 17: 35,947,376 noncoding transcript Het
Gmfb T C 14: 46,816,222 I36V probably benign Het
Gsap G A 5: 21,222,445 probably benign Het
Hectd1 T A 12: 51,782,556 I969L possibly damaging Het
Il21r G T 7: 125,629,840 probably benign Het
Lrrc7 A G 3: 158,161,426 F893L possibly damaging Het
Map2 A G 1: 66,433,580 I1715V probably damaging Het
Mlh3 A G 12: 85,240,854 I1339T possibly damaging Het
Nacad T C 11: 6,599,810 D1127G probably benign Het
Noc3l A G 19: 38,817,927 probably benign Het
Nup93 A G 8: 94,303,665 D384G probably damaging Het
Olfr1036 T A 2: 86,075,302 C187* probably null Het
Olfr474 T C 7: 107,955,226 I195T probably benign Het
Olfr889 C T 9: 38,116,251 L152F probably benign Het
Pls1 A T 9: 95,786,919 probably benign Het
Prkcb A T 7: 122,424,977 H75L probably damaging Het
Rev1 A T 1: 38,074,368 Y539* probably null Het
Rnf10 A T 5: 115,255,447 probably benign Het
Rnpepl1 A G 1: 92,915,860 Y234C probably damaging Het
Sdk2 T C 11: 113,850,891 probably benign Het
Sec23b T A 2: 144,567,912 M240K probably benign Het
Sema5a A T 15: 32,681,609 N945Y probably damaging Het
Snapc4 C A 2: 26,367,216 R799L probably benign Het
Tctn3 T C 19: 40,611,416 probably benign Het
Tfpt G A 7: 3,620,899 Q50* probably null Het
Trim80 T C 11: 115,441,213 V77A probably damaging Het
Trp73 T A 4: 154,064,384 D256V possibly damaging Het
Utrn G T 10: 12,643,601 N2202K probably benign Het
Vps13c T A 9: 67,951,644 F2792Y probably benign Het
Other mutations in Fnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01449:Fnip1 APN 11 54499508 missense probably damaging 1.00
IGL01590:Fnip1 APN 11 54493300 missense probably damaging 1.00
IGL01959:Fnip1 APN 11 54490912 missense possibly damaging 0.95
IGL02157:Fnip1 APN 11 54487763 missense probably damaging 1.00
IGL02197:Fnip1 APN 11 54493374 missense probably damaging 1.00
IGL02476:Fnip1 APN 11 54499567 splice site probably benign
IGL02639:Fnip1 APN 11 54475640 nonsense probably null
IGL02742:Fnip1 APN 11 54493351 missense probably damaging 1.00
hamel UTSW 11 54480685 critical splice donor site probably benign
hamel2 UTSW 11 54502271 missense probably damaging 1.00
Normandy UTSW 11 54493181 splice site probably benign
H8562:Fnip1 UTSW 11 54480297 missense probably damaging 0.98
P0043:Fnip1 UTSW 11 54503225 missense probably benign 0.00
R0114:Fnip1 UTSW 11 54487801 splice site probably benign
R0278:Fnip1 UTSW 11 54489343 splice site probably null
R0840:Fnip1 UTSW 11 54493181 splice site probably benign
R1131:Fnip1 UTSW 11 54493303 missense possibly damaging 0.82
R1205:Fnip1 UTSW 11 54502306 missense possibly damaging 0.91
R1271:Fnip1 UTSW 11 54503297 missense probably benign
R1817:Fnip1 UTSW 11 54502453 missense probably benign 0.30
R1826:Fnip1 UTSW 11 54466164 missense probably damaging 1.00
R1872:Fnip1 UTSW 11 54487735 missense probably damaging 1.00
R1883:Fnip1 UTSW 11 54515547 missense probably damaging 1.00
R1917:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R1918:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R1919:Fnip1 UTSW 11 54480684 missense probably damaging 0.99
R2010:Fnip1 UTSW 11 54482503 missense probably damaging 1.00
R2117:Fnip1 UTSW 11 54500624 missense probably damaging 1.00
R2329:Fnip1 UTSW 11 54466107 missense probably damaging 0.98
R2337:Fnip1 UTSW 11 54475737 missense probably damaging 0.98
R2850:Fnip1 UTSW 11 54502677 missense probably benign 0.32
R2863:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R2864:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R2865:Fnip1 UTSW 11 54502424 missense probably damaging 1.00
R3936:Fnip1 UTSW 11 54480239 splice site probably null
R4017:Fnip1 UTSW 11 54509987 missense probably benign 0.14
R4033:Fnip1 UTSW 11 54502471 missense probably benign 0.02
R4668:Fnip1 UTSW 11 54503559 missense probably damaging 1.00
R4695:Fnip1 UTSW 11 54499419 missense probably damaging 1.00
R4762:Fnip1 UTSW 11 54466171 missense probably damaging 1.00
R4762:Fnip1 UTSW 11 54499526 missense probably benign 0.01
R4777:Fnip1 UTSW 11 54500556 missense probably damaging 1.00
R4863:Fnip1 UTSW 11 54515556 missense possibly damaging 0.52
R5369:Fnip1 UTSW 11 54502589 missense probably benign
R5481:Fnip1 UTSW 11 54502644 missense probably benign 0.01
R5562:Fnip1 UTSW 11 54489342 critical splice donor site probably null
R5563:Fnip1 UTSW 11 54504862 missense probably benign 0.05
R5628:Fnip1 UTSW 11 54503633 missense probably benign 0.08
R5689:Fnip1 UTSW 11 54502289 missense probably damaging 1.00
R6009:Fnip1 UTSW 11 54502271 missense probably damaging 1.00
R6120:Fnip1 UTSW 11 54510000 missense probably benign 0.23
R6429:Fnip1 UTSW 11 54515567 missense probably damaging 1.00
R6546:Fnip1 UTSW 11 54502611 missense probably benign 0.03
R6600:Fnip1 UTSW 11 54503099 missense probably benign
R6882:Fnip1 UTSW 11 54509898 missense probably damaging 1.00
R6966:Fnip1 UTSW 11 54482559 missense probably benign 0.00
R7009:Fnip1 UTSW 11 54502935 missense probably damaging 1.00
R7664:Fnip1 UTSW 11 54466125 missense probably damaging 1.00
R7706:Fnip1 UTSW 11 54515499 missense probably benign 0.41
R7866:Fnip1 UTSW 11 54465402 start gained probably benign
R7939:Fnip1 UTSW 11 54502267 missense probably damaging 1.00
R7943:Fnip1 UTSW 11 54502388 missense probably damaging 1.00
R8429:Fnip1 UTSW 11 54475696 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCTGCCTTAGTCTTCTCACTGTTAGGA -3'
(R):5'- GCTGTGGAGGCGAGCTATGAAA -3'

Sequencing Primer
(F):5'- CATGATGAAGAACAAATTACGGAAC -3'
(R):5'- CGAGCTATGAAAGAACACAGAATGAC -3'
Posted On2013-05-09