Mutagenetix > Incidental Mutations

Incidental Mutation 'R0409:Fnip1'

36531

Institutional Source

Beutler Lab

Gene Symbol

Fnip1

Ensembl Gene

ENSMUSG00000035992

Gene Name

folliculin interacting protein 1

Synonyms

A730024A03Rik

MMRRC Submission

038611-MU

Accession Numbers

Ncbi RefSeq: NM_173753.4; MGI:2444668

Is this an essential gene?

Possibly essential (E-score: 0.655) question?

Stock #

R0409 (G1)

Quality Score

210

Status

Not validated

Chromosome

Chromosomal Location

54438199-54518235 bp(+) (GRCm38)

Type of Mutation

splice site (4 bp from exon)

DNA Base Change (assembly)

A to G at 54480354 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000121399 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046835] [ENSMUST00000143650]

AlphaFold

Q68FD7

Predicted Effect

probably null
Transcript: ENSMUST00000046835

SMART Domains

Protein: ENSMUSP00000049026
Gene: ENSMUSG00000035992

Domain	Start	End	E-Value	Type
Pfam:FNIP_N	41	159	1.7e-29	PFAM
Pfam:FNIP_M	316	549	9.9e-92	PFAM
Pfam:FNIP_C	975	1161	7.6e-73	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000143650

SMART Domains

Protein: ENSMUSP00000121399
Gene: ENSMUSG00000035992

Domain	Start	End	E-Value	Type
Pfam:FNIP_N	17	139	3.9e-36	PFAM
Pfam:FNIP_M	288	526	5.1e-87	PFAM

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.9%
20x: 94.8%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the folliculin-interacting protein family. The encoded protein binds to the tumor suppressor folliculin and to AMP-activated protein kinase (AMPK) and be involved in cellular metabolism and nutrient sensing by regulating the AMPK-mechanistic target of rapamycin signaling pathway. A homologous binding partner of this protein, folliculin-interacting protein 2, has similar binding activities and may suggest functional redundancy within this protein family. Both folliculin-interacting proteins have also been shown to bind the molecular chaperone heat shock protein-90 (Hsp90) and they may function as a co-chaperones in the stabilization of tumor suppressor folliculin which is a target of Hsp90 chaperone activity. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for an ENU-induced or targeted allele exhibit arrested B cell development at the pre-B cell stage with increased B cell apoptosis. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(1) Gene trapped(2)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	A	C	4: 42,972,203	K512T	probably damaging	Het
1700113H08Rik	G	T	10: 87,225,954	A89S	probably damaging	Het
4933417A18Rik	A	T	13: 34,924,549	I5L	probably benign	Het
Alkbh3	T	A	2: 94,001,448	I146F	possibly damaging	Het
Aox2	A	T	1: 58,336,624	I871F	possibly damaging	Het
Birc2	A	C	9: 7,819,384	V509G	possibly damaging	Het
Car7	G	A	8: 104,548,424	A165T	probably damaging	Het
Ccdc81	A	G	7: 89,886,215	V271A	probably benign	Het
Cdc40	G	T	10: 40,847,168	H302N	probably damaging	Het
Cep104	C	T	4: 153,983,053		probably benign	Het
Cfap54	C	A	10: 92,776,213	S3161I	probably benign	Het
Chil5	A	G	3: 106,034,966		probably benign	Het
Chil6	C	T	3: 106,404,176	G96D	probably benign	Het
Cnot1	T	C	8: 95,748,855	K531E	probably damaging	Het
Colgalt2	G	T	1: 152,508,561	A551S	possibly damaging	Het
Disp3	T	G	4: 148,271,959	E148A	probably damaging	Het
Eps8l2	A	G	7: 141,342,980	Y52C	probably damaging	Het
Exph5	C	A	9: 53,374,343	T908K	probably benign	Het
Fat4	C	T	3: 38,977,413	S2449F	probably damaging	Het
Faxc	T	A	4: 21,948,751	N154K	probably benign	Het
Fbxo43	C	T	15: 36,162,357	A235T	probably benign	Het
Fsd1l	T	C	4: 53,679,932	L210P	probably benign	Het
Gm6420	A	C	1: 23,256,038	S123R	unknown	Het
Gm8801	T	G	17: 35,947,376		noncoding transcript	Het
Gmfb	T	C	14: 46,816,222	I36V	probably benign	Het
Gsap	G	A	5: 21,222,445		probably benign	Het
Hectd1	T	A	12: 51,782,556	I969L	possibly damaging	Het
Il21r	G	T	7: 125,629,840		probably benign	Het
Lrrc7	A	G	3: 158,161,426	F893L	possibly damaging	Het
Map2	A	G	1: 66,433,580	I1715V	probably damaging	Het
Mlh3	A	G	12: 85,240,854	I1339T	possibly damaging	Het
Nacad	T	C	11: 6,599,810	D1127G	probably benign	Het
Noc3l	A	G	19: 38,817,927		probably benign	Het
Nup93	A	G	8: 94,303,665	D384G	probably damaging	Het
Olfr1036	T	A	2: 86,075,302	C187*	probably null	Het
Olfr474	T	C	7: 107,955,226	I195T	probably benign	Het
Olfr889	C	T	9: 38,116,251	L152F	probably benign	Het
Pls1	A	T	9: 95,786,919		probably benign	Het
Prkcb	A	T	7: 122,424,977	H75L	probably damaging	Het
Rev1	A	T	1: 38,074,368	Y539*	probably null	Het
Rnf10	A	T	5: 115,255,447		probably benign	Het
Rnpepl1	A	G	1: 92,915,860	Y234C	probably damaging	Het
Sdk2	T	C	11: 113,850,891		probably benign	Het
Sec23b	T	A	2: 144,567,912	M240K	probably benign	Het
Sema5a	A	T	15: 32,681,609	N945Y	probably damaging	Het
Snapc4	C	A	2: 26,367,216	R799L	probably benign	Het
Tctn3	T	C	19: 40,611,416		probably benign	Het
Tfpt	G	A	7: 3,620,899	Q50*	probably null	Het
Trim80	T	C	11: 115,441,213	V77A	probably damaging	Het
Trp73	T	A	4: 154,064,384	D256V	possibly damaging	Het
Utrn	G	T	10: 12,643,601	N2202K	probably benign	Het
Vps13c	T	A	9: 67,951,644	F2792Y	probably benign	Het

Other mutations in Fnip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01449:Fnip1	APN	11	54499508	missense	probably damaging	1.00
IGL01590:Fnip1	APN	11	54493300	missense	probably damaging	1.00
IGL01959:Fnip1	APN	11	54490912	missense	possibly damaging	0.95
IGL02157:Fnip1	APN	11	54487763	missense	probably damaging	1.00
IGL02197:Fnip1	APN	11	54493374	missense	probably damaging	1.00
IGL02476:Fnip1	APN	11	54499567	splice site	probably benign
IGL02639:Fnip1	APN	11	54475640	nonsense	probably null
IGL02742:Fnip1	APN	11	54493351	missense	probably damaging	1.00
hamel	UTSW	11	54480685	critical splice donor site	probably benign
hamel2	UTSW	11	54502271	missense	probably damaging	1.00
Normandy	UTSW	11	54493181	splice site	probably benign
H8562:Fnip1	UTSW	11	54480297	missense	probably damaging	0.98
P0043:Fnip1	UTSW	11	54503225	missense	probably benign	0.00
R0114:Fnip1	UTSW	11	54487801	splice site	probably benign
R0278:Fnip1	UTSW	11	54489343	splice site	probably null
R0840:Fnip1	UTSW	11	54493181	splice site	probably benign
R1131:Fnip1	UTSW	11	54493303	missense	possibly damaging	0.82
R1205:Fnip1	UTSW	11	54502306	missense	possibly damaging	0.91
R1271:Fnip1	UTSW	11	54503297	missense	probably benign
R1817:Fnip1	UTSW	11	54502453	missense	probably benign	0.30
R1826:Fnip1	UTSW	11	54466164	missense	probably damaging	1.00
R1872:Fnip1	UTSW	11	54487735	missense	probably damaging	1.00
R1883:Fnip1	UTSW	11	54515547	missense	probably damaging	1.00
R1917:Fnip1	UTSW	11	54480684	missense	probably damaging	0.99
R1918:Fnip1	UTSW	11	54480684	missense	probably damaging	0.99
R1919:Fnip1	UTSW	11	54480684	missense	probably damaging	0.99
R2010:Fnip1	UTSW	11	54482503	missense	probably damaging	1.00
R2117:Fnip1	UTSW	11	54500624	missense	probably damaging	1.00
R2329:Fnip1	UTSW	11	54466107	missense	probably damaging	0.98
R2337:Fnip1	UTSW	11	54475737	missense	probably damaging	0.98
R2850:Fnip1	UTSW	11	54502677	missense	probably benign	0.32
R2863:Fnip1	UTSW	11	54502424	missense	probably damaging	1.00
R2864:Fnip1	UTSW	11	54502424	missense	probably damaging	1.00
R2865:Fnip1	UTSW	11	54502424	missense	probably damaging	1.00
R3936:Fnip1	UTSW	11	54480239	splice site	probably null
R4017:Fnip1	UTSW	11	54509987	missense	probably benign	0.14
R4033:Fnip1	UTSW	11	54502471	missense	probably benign	0.02
R4668:Fnip1	UTSW	11	54503559	missense	probably damaging	1.00
R4695:Fnip1	UTSW	11	54499419	missense	probably damaging	1.00
R4762:Fnip1	UTSW	11	54466171	missense	probably damaging	1.00
R4762:Fnip1	UTSW	11	54499526	missense	probably benign	0.01
R4777:Fnip1	UTSW	11	54500556	missense	probably damaging	1.00
R4863:Fnip1	UTSW	11	54515556	missense	possibly damaging	0.52
R5369:Fnip1	UTSW	11	54502589	missense	probably benign
R5481:Fnip1	UTSW	11	54502644	missense	probably benign	0.01
R5562:Fnip1	UTSW	11	54489342	critical splice donor site	probably null
R5563:Fnip1	UTSW	11	54504862	missense	probably benign	0.05
R5628:Fnip1	UTSW	11	54503633	missense	probably benign	0.08
R5689:Fnip1	UTSW	11	54502289	missense	probably damaging	1.00
R6009:Fnip1	UTSW	11	54502271	missense	probably damaging	1.00
R6120:Fnip1	UTSW	11	54510000	missense	probably benign	0.23
R6429:Fnip1	UTSW	11	54515567	missense	probably damaging	1.00
R6546:Fnip1	UTSW	11	54502611	missense	probably benign	0.03
R6600:Fnip1	UTSW	11	54503099	missense	probably benign
R6882:Fnip1	UTSW	11	54509898	missense	probably damaging	1.00
R6966:Fnip1	UTSW	11	54482559	missense	probably benign	0.00
R7009:Fnip1	UTSW	11	54502935	missense	probably damaging	1.00
R7664:Fnip1	UTSW	11	54466125	missense	probably damaging	1.00
R7706:Fnip1	UTSW	11	54515499	missense	probably benign	0.41
R7866:Fnip1	UTSW	11	54465402	start gained	probably benign
R7939:Fnip1	UTSW	11	54502267	missense	probably damaging	1.00
R7943:Fnip1	UTSW	11	54502388	missense	probably damaging	1.00
R8429:Fnip1	UTSW	11	54475696	missense	possibly damaging	0.94
R8546:Fnip1	UTSW	11	54510000	missense	probably benign	0.23
R8753:Fnip1	UTSW	11	54510041	missense	probably damaging	0.99
R8834:Fnip1	UTSW	11	54504755	missense	possibly damaging	0.83
R8875:Fnip1	UTSW	11	54515554	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGCCTTAGTCTTCTCACTGTTAGGA -3'
(R):5'- GCTGTGGAGGCGAGCTATGAAA -3'

Sequencing Primer
(F):5'- CATGATGAAGAACAAATTACGGAAC -3'
(R):5'- CGAGCTATGAAAGAACACAGAATGAC -3'

Posted On

2013-05-09