Incidental Mutation 'R0410:Tor1aip1'
ID36543
Institutional Source Beutler Lab
Gene Symbol Tor1aip1
Ensembl Gene ENSMUSG00000026466
Gene Nametorsin A interacting protein 1
SynonymsLAP1
MMRRC Submission 038612-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0410 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location156004599-156036480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 156035940 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 99 (V99A)
Ref Sequence ENSEMBL: ENSMUSP00000137617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027738] [ENSMUST00000060404] [ENSMUST00000065648] [ENSMUST00000097526] [ENSMUST00000097527] [ENSMUST00000111754] [ENSMUST00000111757] [ENSMUST00000128941] [ENSMUST00000130995] [ENSMUST00000133152] [ENSMUST00000136331] [ENSMUST00000136397] [ENSMUST00000141878] [ENSMUST00000169241]
Predicted Effect probably benign
Transcript: ENSMUST00000027738
AA Change: V99A

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000027738
Gene: ENSMUSG00000026466
AA Change: V99A

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
Pfam:LAP1C 122 265 9.1e-36 PFAM
Pfam:LAP1C 257 520 6.7e-171 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060404
SMART Domains Protein: ENSMUSP00000050817
Gene: ENSMUSG00000050565

DomainStartEndE-ValueType
Pfam:LAP1C 26 501 3.9e-222 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065648
Predicted Effect probably benign
Transcript: ENSMUST00000097526
Predicted Effect probably benign
Transcript: ENSMUST00000097527
AA Change: V99A

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000095134
Gene: ENSMUSG00000026466
AA Change: V99A

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
low complexity region 149 167 N/A INTRINSIC
Pfam:LAP1C 244 576 1.9e-165 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111754
Predicted Effect probably benign
Transcript: ENSMUST00000111757
SMART Domains Protein: ENSMUSP00000107387
Gene: ENSMUSG00000050565

DomainStartEndE-ValueType
Pfam:LAP1C 26 501 3.9e-169 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000123705
AA Change: V37A
SMART Domains Protein: ENSMUSP00000120602
Gene: ENSMUSG00000026466
AA Change: V37A

DomainStartEndE-ValueType
Pfam:LAP1C 1 59 4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128941
Predicted Effect possibly damaging
Transcript: ENSMUST00000130995
AA Change: V99A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141619
Gene: ENSMUSG00000026466
AA Change: V99A

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
Pfam:LAP1C 122 273 3.8e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131359
Predicted Effect probably benign
Transcript: ENSMUST00000133152
Predicted Effect possibly damaging
Transcript: ENSMUST00000136331
AA Change: V99A

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137617
Gene: ENSMUSG00000026466
AA Change: V99A

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
Pfam:LAP1C 122 283 8.4e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136397
SMART Domains Protein: ENSMUSP00000118654
Gene: ENSMUSG00000026466

DomainStartEndE-ValueType
Pfam:LAP1C 1 77 5.6e-15 PFAM
Pfam:LAP1C 74 190 5.7e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141878
SMART Domains Protein: ENSMUSP00000123391
Gene: ENSMUSG00000026466

DomainStartEndE-ValueType
Pfam:LAP1C 1 176 1.4e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141980
Predicted Effect probably benign
Transcript: ENSMUST00000169241
SMART Domains Protein: ENSMUSP00000126751
Gene: ENSMUSG00000026466

DomainStartEndE-ValueType
Pfam:LAP1C 1 77 1.6e-14 PFAM
Pfam:LAP1C 75 391 2.4e-195 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 2 integral membrane protein that binds A- and B-type lamins. The encoded protein localizes to the inner nuclear membrane and may be involved in maintaining the attachment of the nuclear membrane to the nuclear lamina during cell division. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit perinatal lethality and nuclear membrane blebs in neural and nonneural tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,469,732 D170G probably benign Het
Actrt3 C T 3: 30,598,124 G274S probably benign Het
Adamts18 G T 8: 113,714,358 C889* probably null Het
AF529169 T G 9: 89,602,203 E380D probably damaging Het
Alkbh6 C T 7: 30,312,606 P104S probably damaging Het
Alms1 A T 6: 85,587,803 E53V unknown Het
Ap3s1 T C 18: 46,779,212 C100R probably benign Het
Apbb2 G T 5: 66,451,806 A166E possibly damaging Het
Asph A G 4: 9,595,415 V174A probably damaging Het
Cacna2d2 T C 9: 107,524,620 L758P probably damaging Het
Cacng5 A G 11: 107,877,369 S271P possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Chn1 A T 2: 73,631,750 C236* probably null Het
Coro1b T C 19: 4,149,363 V7A probably damaging Het
Dhx16 A G 17: 35,890,967 Y962C probably damaging Het
Dixdc1 T C 9: 50,684,853 D152G probably damaging Het
Dmrt1 T C 19: 25,506,103 S84P probably damaging Het
Dnah10 A G 5: 124,755,735 D844G probably benign Het
Edn3 C T 2: 174,761,689 P77S possibly damaging Het
Efcab7 T C 4: 99,878,285 probably null Het
Fam83g A G 11: 61,703,392 D584G probably damaging Het
Fbxo7 T A 10: 86,029,238 probably null Het
Ffar1 T C 7: 30,860,630 T281A probably benign Het
Fntb T C 12: 76,888,052 V201A probably benign Het
Gart C A 16: 91,641,327 A101S probably damaging Het
Gbp9 T C 5: 105,085,073 T238A probably benign Het
Hectd4 T C 5: 121,286,266 L663S possibly damaging Het
Helz2 A T 2: 181,230,593 V2512E probably damaging Het
Hip1 A C 5: 135,458,155 L66R probably damaging Het
Iigp1 T A 18: 60,390,303 D164E probably benign Het
Kcnip3 A G 2: 127,460,066 S193P probably damaging Het
Klra9 T A 6: 130,188,744 T103S probably benign Het
Meis2 T C 2: 115,864,228 *471W probably null Het
Mrpl21 T C 19: 3,284,792 S45P possibly damaging Het
Mterf1b A G 5: 4,196,488 E43G probably benign Het
Mycbp2 G T 14: 103,135,133 S4092R probably damaging Het
Nfatc3 A T 8: 106,096,196 N538I probably damaging Het
Nphp4 T C 4: 152,557,046 C1095R probably benign Het
Npm2 T A 14: 70,652,553 T13S probably benign Het
Olfr24 C A 9: 18,754,841 V265F probably damaging Het
Olfr872 T A 9: 20,260,501 F220L probably benign Het
Plcg2 A T 8: 117,615,373 I1158F probably damaging Het
Popdc3 T C 10: 45,317,733 V210A possibly damaging Het
Postn T C 3: 54,385,277 L755S possibly damaging Het
Prdx6b T C 2: 80,293,029 F61L probably damaging Het
Rars C T 11: 35,826,020 R223H probably damaging Het
Robo1 G A 16: 72,971,984 G479D possibly damaging Het
Scaf4 A G 16: 90,260,170 Y98H unknown Het
Scn4a A G 11: 106,323,949 I1274T probably damaging Het
Senp2 G T 16: 22,009,694 R18L probably damaging Het
Six5 T A 7: 19,096,456 V336D probably damaging Het
Slc31a2 G A 4: 62,292,653 E8K probably benign Het
Slc4a7 A T 14: 14,738,299 T184S probably damaging Het
Slco2a1 T A 9: 103,073,314 probably null Het
Smr3a T G 5: 88,008,211 probably benign Het
Sqor T C 2: 122,787,522 V100A probably benign Het
Srarp T C 4: 141,433,148 N125D possibly damaging Het
Stam T C 2: 14,138,991 V364A probably benign Het
Tgm5 T C 2: 121,077,558 I46V possibly damaging Het
Tie1 A T 4: 118,480,569 V443E probably damaging Het
Tipin T C 9: 64,288,115 M1T probably null Het
Tnc T C 4: 64,007,694 T950A probably benign Het
Tns3 T C 11: 8,435,852 D1382G probably benign Het
Trim16 C T 11: 62,820,471 probably benign Het
Ttn G T 2: 76,788,357 N14448K possibly damaging Het
Ttn C T 2: 76,886,860 probably benign Het
Vmn1r23 A G 6: 57,926,190 I201T probably benign Het
Vmn2r13 T A 5: 109,173,813 K339N probably benign Het
Yap1 A G 9: 8,001,467 Y173H probably damaging Het
Zcchc11 A G 4: 108,486,555 R255G probably benign Het
Other mutations in Tor1aip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Tor1aip1 APN 1 156031467 missense probably benign 0.01
IGL00837:Tor1aip1 APN 1 156006916 utr 3 prime probably benign
IGL02573:Tor1aip1 APN 1 156013371 missense probably damaging 0.99
IGL02815:Tor1aip1 APN 1 156035916 missense probably damaging 1.00
IGL02964:Tor1aip1 APN 1 156035844 missense probably damaging 0.96
IGL03128:Tor1aip1 APN 1 156007035 missense probably damaging 1.00
R0100:Tor1aip1 UTSW 1 156007075 missense probably damaging 1.00
R0319:Tor1aip1 UTSW 1 156007181 missense probably damaging 1.00
R0458:Tor1aip1 UTSW 1 156030407 missense probably damaging 0.99
R0506:Tor1aip1 UTSW 1 156007674 nonsense probably null
R0563:Tor1aip1 UTSW 1 156035808 missense probably damaging 1.00
R1696:Tor1aip1 UTSW 1 156017516 missense possibly damaging 0.67
R1745:Tor1aip1 UTSW 1 156030434 splice site probably null
R1830:Tor1aip1 UTSW 1 156007562 missense probably damaging 1.00
R2132:Tor1aip1 UTSW 1 156007562 missense probably damaging 1.00
R4487:Tor1aip1 UTSW 1 156007124 missense probably damaging 1.00
R5613:Tor1aip1 UTSW 1 156033753 missense probably damaging 0.98
R5657:Tor1aip1 UTSW 1 156007488 missense probably damaging 1.00
R6123:Tor1aip1 UTSW 1 156007205 missense probably damaging 1.00
R6380:Tor1aip1 UTSW 1 156018488 missense possibly damaging 0.85
R6647:Tor1aip1 UTSW 1 156018253 missense possibly damaging 0.94
R6852:Tor1aip1 UTSW 1 156035820 missense probably damaging 0.99
R7354:Tor1aip1 UTSW 1 156036113 missense probably damaging 0.98
R7463:Tor1aip1 UTSW 1 156007609 missense possibly damaging 0.48
R7615:Tor1aip1 UTSW 1 156007584 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AACTGAAGCTCCAGGACTAGGCAG -3'
(R):5'- AAGGTTGGGCCATCTACGTCACAC -3'

Sequencing Primer
(F):5'- TGGACTCAATCCGGGAGTG -3'
(R):5'- TGGCGACAGCAGTGACG -3'
Posted On2013-05-09