Incidental Mutation 'R0410:Hectd4'
ID 36576
Institutional Source Beutler Lab
Gene Symbol Hectd4
Ensembl Gene ENSMUSG00000042744
Gene Name HECT domain E3 ubiquitin protein ligase 4
Synonyms Gm15800
MMRRC Submission 038612-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.913) question?
Stock # R0410 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 121220219-121368577 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 121286266 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Serine at position 663 (L663S)
Ref Sequence ENSEMBL: ENSMUSP00000048345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042614]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000042614
AA Change: L663S

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048345
Gene: ENSMUSG00000042744
AA Change: L663S

DomainStartEndE-ValueType
low complexity region 224 234 N/A INTRINSIC
low complexity region 266 282 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
low complexity region 725 735 N/A INTRINSIC
low complexity region 1252 1265 N/A INTRINSIC
coiled coil region 1372 1398 N/A INTRINSIC
low complexity region 1551 1562 N/A INTRINSIC
low complexity region 1725 1741 N/A INTRINSIC
low complexity region 1892 1904 N/A INTRINSIC
low complexity region 2656 2666 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
low complexity region 2901 2917 N/A INTRINSIC
low complexity region 2921 2933 N/A INTRINSIC
low complexity region 3232 3246 N/A INTRINSIC
low complexity region 3275 3335 N/A INTRINSIC
low complexity region 3441 3448 N/A INTRINSIC
low complexity region 3473 3506 N/A INTRINSIC
low complexity region 3512 3533 N/A INTRINSIC
low complexity region 3540 3554 N/A INTRINSIC
low complexity region 3794 3822 N/A INTRINSIC
HECTc 4048 4412 4.78e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128514
Predicted Effect unknown
Transcript: ENSMUST00000201669
AA Change: L12S
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik A G 13: 119,469,732 D170G probably benign Het
Actrt3 C T 3: 30,598,124 G274S probably benign Het
Adamts18 G T 8: 113,714,358 C889* probably null Het
AF529169 T G 9: 89,602,203 E380D probably damaging Het
Alkbh6 C T 7: 30,312,606 P104S probably damaging Het
Alms1 A T 6: 85,587,803 E53V unknown Het
Ap3s1 T C 18: 46,779,212 C100R probably benign Het
Apbb2 G T 5: 66,451,806 A166E possibly damaging Het
Asph A G 4: 9,595,415 V174A probably damaging Het
Cacna2d2 T C 9: 107,524,620 L758P probably damaging Het
Cacng5 A G 11: 107,877,369 S271P possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Chn1 A T 2: 73,631,750 C236* probably null Het
Coro1b T C 19: 4,149,363 V7A probably damaging Het
Dhx16 A G 17: 35,890,967 Y962C probably damaging Het
Dixdc1 T C 9: 50,684,853 D152G probably damaging Het
Dmrt1 T C 19: 25,506,103 S84P probably damaging Het
Dnah10 A G 5: 124,755,735 D844G probably benign Het
Edn3 C T 2: 174,761,689 P77S possibly damaging Het
Efcab7 T C 4: 99,878,285 probably null Het
Fam83g A G 11: 61,703,392 D584G probably damaging Het
Fbxo7 T A 10: 86,029,238 probably null Het
Ffar1 T C 7: 30,860,630 T281A probably benign Het
Fntb T C 12: 76,888,052 V201A probably benign Het
Gart C A 16: 91,641,327 A101S probably damaging Het
Gbp9 T C 5: 105,085,073 T238A probably benign Het
Helz2 A T 2: 181,230,593 V2512E probably damaging Het
Hip1 A C 5: 135,458,155 L66R probably damaging Het
Iigp1 T A 18: 60,390,303 D164E probably benign Het
Kcnip3 A G 2: 127,460,066 S193P probably damaging Het
Klra9 T A 6: 130,188,744 T103S probably benign Het
Meis2 T C 2: 115,864,228 *471W probably null Het
Mrpl21 T C 19: 3,284,792 S45P possibly damaging Het
Mterf1b A G 5: 4,196,488 E43G probably benign Het
Mycbp2 G T 14: 103,135,133 S4092R probably damaging Het
Nfatc3 A T 8: 106,096,196 N538I probably damaging Het
Nphp4 T C 4: 152,557,046 C1095R probably benign Het
Npm2 T A 14: 70,652,553 T13S probably benign Het
Olfr24 C A 9: 18,754,841 V265F probably damaging Het
Olfr872 T A 9: 20,260,501 F220L probably benign Het
Plcg2 A T 8: 117,615,373 I1158F probably damaging Het
Popdc3 T C 10: 45,317,733 V210A possibly damaging Het
Postn T C 3: 54,385,277 L755S possibly damaging Het
Prdx6b T C 2: 80,293,029 F61L probably damaging Het
Rars C T 11: 35,826,020 R223H probably damaging Het
Robo1 G A 16: 72,971,984 G479D possibly damaging Het
Scaf4 A G 16: 90,260,170 Y98H unknown Het
Scn4a A G 11: 106,323,949 I1274T probably damaging Het
Senp2 G T 16: 22,009,694 R18L probably damaging Het
Six5 T A 7: 19,096,456 V336D probably damaging Het
Slc31a2 G A 4: 62,292,653 E8K probably benign Het
Slc4a7 A T 14: 14,738,299 T184S probably damaging Het
Slco2a1 T A 9: 103,073,314 probably null Het
Smr3a T G 5: 88,008,211 probably benign Het
Sqor T C 2: 122,787,522 V100A probably benign Het
Srarp T C 4: 141,433,148 N125D possibly damaging Het
Stam T C 2: 14,138,991 V364A probably benign Het
Tgm5 T C 2: 121,077,558 I46V possibly damaging Het
Tie1 A T 4: 118,480,569 V443E probably damaging Het
Tipin T C 9: 64,288,115 M1T probably null Het
Tnc T C 4: 64,007,694 T950A probably benign Het
Tns3 T C 11: 8,435,852 D1382G probably benign Het
Tor1aip1 A G 1: 156,035,940 V99A possibly damaging Het
Trim16 C T 11: 62,820,471 probably benign Het
Ttn G T 2: 76,788,357 N14448K possibly damaging Het
Ttn C T 2: 76,886,860 probably benign Het
Vmn1r23 A G 6: 57,926,190 I201T probably benign Het
Vmn2r13 T A 5: 109,173,813 K339N probably benign Het
Yap1 A G 9: 8,001,467 Y173H probably damaging Het
Zcchc11 A G 4: 108,486,555 R255G probably benign Het
Other mutations in Hectd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Hectd4 APN 5 121363870 missense possibly damaging 0.51
IGL00976:Hectd4 APN 5 121349106 missense probably benign 0.18
IGL01085:Hectd4 APN 5 121331701 missense probably damaging 1.00
IGL01112:Hectd4 APN 5 121306950 missense probably benign 0.01
IGL01402:Hectd4 APN 5 121339417 splice site probably benign
IGL01474:Hectd4 APN 5 121336649 missense possibly damaging 0.53
IGL01503:Hectd4 APN 5 121318651 missense probably benign 0.28
IGL01548:Hectd4 APN 5 121364660 missense possibly damaging 0.71
IGL01656:Hectd4 APN 5 121322700 missense probably damaging 0.99
IGL01756:Hectd4 APN 5 121344824 missense probably benign 0.28
IGL01819:Hectd4 APN 5 121328418 missense possibly damaging 0.85
IGL02080:Hectd4 APN 5 121366606 utr 3 prime probably benign
IGL02488:Hectd4 APN 5 121292087 missense probably benign 0.33
IGL02490:Hectd4 APN 5 121318613 missense possibly damaging 0.82
IGL02558:Hectd4 APN 5 121344785 missense probably benign 0.28
IGL02626:Hectd4 APN 5 121353881 missense possibly damaging 0.86
IGL02649:Hectd4 APN 5 121349402 missense possibly damaging 0.73
IGL02736:Hectd4 APN 5 121342719 missense possibly damaging 0.73
IGL02861:Hectd4 APN 5 121307004 missense possibly damaging 0.81
IGL02880:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02889:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02953:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL02969:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03031:Hectd4 APN 5 121348794 missense possibly damaging 0.96
IGL03066:Hectd4 APN 5 121365053 missense possibly damaging 0.93
IGL03160:Hectd4 APN 5 121259879 missense probably benign
IGL03181:Hectd4 APN 5 121353958 missense possibly damaging 0.91
IGL03265:Hectd4 APN 5 121259939 splice site probably benign
IGL03375:Hectd4 APN 5 121328382 missense possibly damaging 0.72
Achilles UTSW 5 121307381 nonsense probably null
agamemnon UTSW 5 121253858 splice site probably benign
clymnestra UTSW 5 121334375 missense possibly damaging 0.86
hector UTSW 5 121315437 missense probably damaging 1.00
helen UTSW 5 121310663 missense probably damaging 0.97
Merriwether UTSW 5 121353551 missense possibly damaging 0.53
PIT4466001:Hectd4 UTSW 5 121333060 critical splice donor site probably null
R0018:Hectd4 UTSW 5 121254179 missense possibly damaging 0.53
R0024:Hectd4 UTSW 5 121308576 missense possibly damaging 0.92
R0030:Hectd4 UTSW 5 121262588 nonsense probably null
R0080:Hectd4 UTSW 5 121349372 missense probably benign 0.18
R0110:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0110:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0115:Hectd4 UTSW 5 121295506 splice site probably benign
R0128:Hectd4 UTSW 5 121349243 missense possibly damaging 0.86
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0131:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0132:Hectd4 UTSW 5 121333024 missense probably benign 0.44
R0244:Hectd4 UTSW 5 121329605 missense probably benign 0.33
R0281:Hectd4 UTSW 5 121254251 missense possibly damaging 0.85
R0329:Hectd4 UTSW 5 121259864 missense probably benign
R0422:Hectd4 UTSW 5 121343082 splice site probably null
R0442:Hectd4 UTSW 5 121323982 missense possibly damaging 0.66
R0449:Hectd4 UTSW 5 121364590 splice site probably null
R0469:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0469:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0481:Hectd4 UTSW 5 121295506 splice site probably benign
R0510:Hectd4 UTSW 5 121281896 missense possibly damaging 0.90
R0510:Hectd4 UTSW 5 121305673 missense possibly damaging 0.53
R0520:Hectd4 UTSW 5 121331707 missense possibly damaging 0.53
R0534:Hectd4 UTSW 5 121348476 missense possibly damaging 0.96
R0603:Hectd4 UTSW 5 121304337 missense possibly damaging 0.46
R0617:Hectd4 UTSW 5 121343232 splice site probably benign
R0622:Hectd4 UTSW 5 121348625 missense possibly damaging 0.53
R0626:Hectd4 UTSW 5 121277824 missense probably benign 0.18
R0708:Hectd4 UTSW 5 121286463 critical splice donor site probably null
R0710:Hectd4 UTSW 5 121336628 missense probably benign 0.08
R0763:Hectd4 UTSW 5 121307033 unclassified probably benign
R0764:Hectd4 UTSW 5 121286769 missense possibly damaging 0.46
R1123:Hectd4 UTSW 5 121286736 missense probably damaging 0.96
R1129:Hectd4 UTSW 5 121310599 missense possibly damaging 0.66
R1204:Hectd4 UTSW 5 121350485 missense possibly damaging 0.85
R1237:Hectd4 UTSW 5 121321507 missense possibly damaging 0.90
R1257:Hectd4 UTSW 5 121318624 nonsense probably null
R1391:Hectd4 UTSW 5 121353695 missense possibly damaging 0.96
R1395:Hectd4 UTSW 5 121328513 critical splice donor site probably null
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1468:Hectd4 UTSW 5 121349172 missense possibly damaging 0.65
R1545:Hectd4 UTSW 5 121323956 missense possibly damaging 0.87
R1553:Hectd4 UTSW 5 121349259 missense probably benign 0.00
R1572:Hectd4 UTSW 5 121301878 missense possibly damaging 0.85
R1662:Hectd4 UTSW 5 121317245 missense probably benign 0.01
R1705:Hectd4 UTSW 5 121298104 missense probably benign
R1715:Hectd4 UTSW 5 121344818 missense possibly damaging 0.85
R1728:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1736:Hectd4 UTSW 5 121349530 missense possibly damaging 0.53
R1768:Hectd4 UTSW 5 121358303 missense possibly damaging 0.70
R1775:Hectd4 UTSW 5 121291191 splice site probably benign
R1784:Hectd4 UTSW 5 121301839 missense possibly damaging 0.51
R1843:Hectd4 UTSW 5 121297180 missense possibly damaging 0.53
R1914:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R1915:Hectd4 UTSW 5 121322294 missense probably benign 0.08
R2024:Hectd4 UTSW 5 121281918 missense possibly damaging 0.86
R2103:Hectd4 UTSW 5 121355629 missense probably benign 0.04
R2108:Hectd4 UTSW 5 121333424 missense possibly damaging 0.72
R2124:Hectd4 UTSW 5 121318639 missense probably damaging 0.97
R2150:Hectd4 UTSW 5 121253858 splice site probably benign
R2192:Hectd4 UTSW 5 121315143 missense possibly damaging 0.46
R2301:Hectd4 UTSW 5 121353537 missense probably benign 0.18
R2324:Hectd4 UTSW 5 121315437 missense probably damaging 1.00
R2331:Hectd4 UTSW 5 121320026 missense probably benign 0.05
R2504:Hectd4 UTSW 5 121220620 missense unknown
R2504:Hectd4 UTSW 5 121263967 missense possibly damaging 0.73
R2904:Hectd4 UTSW 5 121292724 splice site probably benign
R3843:Hectd4 UTSW 5 121259873 missense possibly damaging 0.72
R3934:Hectd4 UTSW 5 121320101 critical splice donor site probably null
R3944:Hectd4 UTSW 5 121303525 splice site probably benign
R4133:Hectd4 UTSW 5 121277834 critical splice donor site probably null
R4271:Hectd4 UTSW 5 121220504 small deletion probably benign
R4413:Hectd4 UTSW 5 121350481 missense possibly damaging 0.53
R4456:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R4489:Hectd4 UTSW 5 121286257 missense possibly damaging 0.73
R4539:Hectd4 UTSW 5 121314907 nonsense probably null
R4564:Hectd4 UTSW 5 121350431 missense probably benign 0.33
R4582:Hectd4 UTSW 5 121286419 missense possibly damaging 0.53
R4629:Hectd4 UTSW 5 121297203 missense probably benign 0.01
R4633:Hectd4 UTSW 5 121349216 missense probably benign 0.33
R4643:Hectd4 UTSW 5 121349055 missense possibly damaging 0.53
R4679:Hectd4 UTSW 5 121325251 missense possibly damaging 0.72
R4681:Hectd4 UTSW 5 121303615 missense possibly damaging 0.86
R4734:Hectd4 UTSW 5 121341977 missense possibly damaging 0.53
R4739:Hectd4 UTSW 5 121348442 missense probably benign
R4781:Hectd4 UTSW 5 121306107 critical splice donor site probably null
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4860:Hectd4 UTSW 5 121305818 missense probably benign 0.04
R4869:Hectd4 UTSW 5 121322672 missense possibly damaging 0.46
R4909:Hectd4 UTSW 5 121263891 missense probably benign 0.18
R4922:Hectd4 UTSW 5 121359315 missense possibly damaging 0.86
R4925:Hectd4 UTSW 5 121322690 missense possibly damaging 0.83
R5004:Hectd4 UTSW 5 121328199 splice site probably null
R5004:Hectd4 UTSW 5 121329565 missense possibly damaging 0.93
R5129:Hectd4 UTSW 5 121343510 missense possibly damaging 0.87
R5217:Hectd4 UTSW 5 121353551 missense possibly damaging 0.53
R5267:Hectd4 UTSW 5 121344824 missense probably benign 0.28
R5344:Hectd4 UTSW 5 121343676 missense probably benign 0.28
R5345:Hectd4 UTSW 5 121263974 missense possibly damaging 0.85
R5347:Hectd4 UTSW 5 121304448 missense probably benign 0.33
R5360:Hectd4 UTSW 5 121315401 missense possibly damaging 0.90
R5363:Hectd4 UTSW 5 121310603 missense probably benign 0.04
R5445:Hectd4 UTSW 5 121266274 missense probably benign 0.00
R5479:Hectd4 UTSW 5 121306948 missense probably benign
R5507:Hectd4 UTSW 5 121281101 missense unknown
R5552:Hectd4 UTSW 5 121342851 missense possibly damaging 0.96
R5691:Hectd4 UTSW 5 121348815 missense possibly damaging 0.85
R5745:Hectd4 UTSW 5 121353502 missense possibly damaging 0.96
R5757:Hectd4 UTSW 5 121348619 missense possibly damaging 0.72
R5845:Hectd4 UTSW 5 121307524 critical splice donor site probably null
R5869:Hectd4 UTSW 5 121343225 critical splice donor site probably null
R5913:Hectd4 UTSW 5 121323974 missense possibly damaging 0.83
R5920:Hectd4 UTSW 5 121308271 missense possibly damaging 0.65
R5943:Hectd4 UTSW 5 121322294 missense probably benign 0.01
R6219:Hectd4 UTSW 5 121308878 missense possibly damaging 0.92
R6250:Hectd4 UTSW 5 121339498 missense possibly damaging 0.85
R6301:Hectd4 UTSW 5 121254220 missense possibly damaging 0.91
R6428:Hectd4 UTSW 5 121350445 missense possibly damaging 0.53
R6446:Hectd4 UTSW 5 121334375 missense possibly damaging 0.86
R6453:Hectd4 UTSW 5 121350592 missense probably damaging 1.00
R6513:Hectd4 UTSW 5 121356196 splice site probably null
R6540:Hectd4 UTSW 5 121303571 missense probably benign 0.33
R6706:Hectd4 UTSW 5 121320084 missense possibly damaging 0.92
R6720:Hectd4 UTSW 5 121307381 nonsense probably null
R6736:Hectd4 UTSW 5 121277725 missense possibly damaging 0.86
R6776:Hectd4 UTSW 5 121353511 missense possibly damaging 0.85
R7033:Hectd4 UTSW 5 121364568 missense possibly damaging 0.86
R7038:Hectd4 UTSW 5 121299597 missense possibly damaging 0.90
R7175:Hectd4 UTSW 5 121273629 missense possibly damaging 0.85
R7180:Hectd4 UTSW 5 121308342 missense probably benign 0.01
R7234:Hectd4 UTSW 5 121329073 missense possibly damaging 0.53
R7253:Hectd4 UTSW 5 121314881 missense possibly damaging 0.66
R7349:Hectd4 UTSW 5 121310663 missense probably damaging 0.97
R7450:Hectd4 UTSW 5 121281932 missense probably benign 0.00
R7467:Hectd4 UTSW 5 121323961 missense possibly damaging 0.66
R7475:Hectd4 UTSW 5 121358133 splice site probably null
R7482:Hectd4 UTSW 5 121363878 missense possibly damaging 0.71
R7512:Hectd4 UTSW 5 121297109 missense possibly damaging 0.72
R7525:Hectd4 UTSW 5 121343665 missense possibly damaging 0.70
R7559:Hectd4 UTSW 5 121315510 splice site probably null
R7560:Hectd4 UTSW 5 121254342 missense possibly damaging 0.53
R7561:Hectd4 UTSW 5 121291225 missense possibly damaging 0.91
R7576:Hectd4 UTSW 5 121349459 missense possibly damaging 0.91
R7584:Hectd4 UTSW 5 121318735 missense possibly damaging 0.83
R7648:Hectd4 UTSW 5 121254371 missense possibly damaging 0.73
R7663:Hectd4 UTSW 5 121324031 missense probably benign 0.06
R7692:Hectd4 UTSW 5 121321564 missense possibly damaging 0.46
R7725:Hectd4 UTSW 5 121220617 missense unknown
R7731:Hectd4 UTSW 5 121307014 missense probably benign 0.00
R7732:Hectd4 UTSW 5 121336629 missense probably benign 0.14
R7782:Hectd4 UTSW 5 121305721 missense possibly damaging 0.53
R7854:Hectd4 UTSW 5 121329568 missense probably benign 0.27
R7898:Hectd4 UTSW 5 121331817 missense probably benign 0.18
R7910:Hectd4 UTSW 5 121254228 missense possibly damaging 0.86
R7962:Hectd4 UTSW 5 121310629 missense probably damaging 0.98
R8003:Hectd4 UTSW 5 121339518 missense possibly damaging 0.85
R8098:Hectd4 UTSW 5 121321398 missense possibly damaging 0.46
R8110:Hectd4 UTSW 5 121332949 missense possibly damaging 0.96
R8118:Hectd4 UTSW 5 121286376 missense probably benign 0.33
R8348:Hectd4 UTSW 5 121220256 start gained probably benign
R8397:Hectd4 UTSW 5 121259894 missense probably damaging 0.98
R8436:Hectd4 UTSW 5 121308358 missense possibly damaging 0.90
R8436:Hectd4 UTSW 5 121343147 missense probably benign 0.00
R8443:Hectd4 UTSW 5 121329109 missense possibly damaging 0.72
R8448:Hectd4 UTSW 5 121220256 start gained probably benign
R8516:Hectd4 UTSW 5 121349010 missense possibly damaging 0.53
R8519:Hectd4 UTSW 5 121304426 nonsense probably null
R8553:Hectd4 UTSW 5 121353598 missense possibly damaging 0.73
R8557:Hectd4 UTSW 5 121310651 missense possibly damaging 0.66
R8725:Hectd4 UTSW 5 121350494 missense probably damaging 1.00
R8751:Hectd4 UTSW 5 121363775 nonsense probably null
R8769:Hectd4 UTSW 5 121281873 missense possibly damaging 0.53
R8803:Hectd4 UTSW 5 121323931 missense probably benign 0.01
R8887:Hectd4 UTSW 5 121295478 missense probably benign 0.44
R8982:Hectd4 UTSW 5 121328242 missense probably benign 0.02
R8988:Hectd4 UTSW 5 121277756 missense possibly damaging 0.86
R8991:Hectd4 UTSW 5 121358284 missense probably benign 0.33
R8994:Hectd4 UTSW 5 121303566 missense probably benign 0.33
R8995:Hectd4 UTSW 5 121254359 missense possibly damaging 0.96
R9049:Hectd4 UTSW 5 121313892 missense possibly damaging 0.92
R9093:Hectd4 UTSW 5 121273614 missense probably benign 0.14
R9106:Hectd4 UTSW 5 121329556 missense possibly damaging 0.53
R9137:Hectd4 UTSW 5 121358175 missense possibly damaging 0.53
R9146:Hectd4 UTSW 5 121349034 missense probably benign 0.33
R9154:Hectd4 UTSW 5 121253904 missense
R9162:Hectd4 UTSW 5 121306979 missense possibly damaging 0.66
R9166:Hectd4 UTSW 5 121308627 missense probably damaging 0.96
R9183:Hectd4 UTSW 5 121299488 missense possibly damaging 0.51
R9207:Hectd4 UTSW 5 121295433 missense possibly damaging 0.86
R9291:Hectd4 UTSW 5 121348965 missense probably benign 0.14
R9300:Hectd4 UTSW 5 121348889 missense probably benign 0.33
R9314:Hectd4 UTSW 5 121299645 critical splice donor site probably null
R9381:Hectd4 UTSW 5 121334429 missense possibly damaging 0.53
R9432:Hectd4 UTSW 5 121322801 missense probably benign 0.01
R9491:Hectd4 UTSW 5 121314918 missense probably damaging 0.97
R9532:Hectd4 UTSW 5 121364553 missense probably benign 0.00
R9557:Hectd4 UTSW 5 121321554 missense not run
R9561:Hectd4 UTSW 5 121334469 missense not run
R9593:Hectd4 UTSW 5 121286781 nonsense probably null
X0026:Hectd4 UTSW 5 121349637 missense probably benign 0.04
X0027:Hectd4 UTSW 5 121321404 missense probably benign 0.27
Z1088:Hectd4 UTSW 5 121295503 splice site probably null
Z1177:Hectd4 UTSW 5 121358320 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAACAACATTGGCACTTTTGGGC -3'
(R):5'- CCATGTGCAACGCATAGGATGGAG -3'

Sequencing Primer
(F):5'- CTGTACCCTGGAGAGTTGTTCT -3'
(R):5'- CACATATGCTGACATGTACCTG -3'
Posted On 2013-05-09