Incidental Mutation 'R4765:Cflar'
ID 366027
Institutional Source Beutler Lab
Gene Symbol Cflar
Ensembl Gene ENSMUSG00000026031
Gene Name CASP8 and FADD-like apoptosis regulator
Synonyms Flip, 2310024N18Rik, A430105C05Rik, Cash, Casper, c-Flip
MMRRC Submission 042406-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4765 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 58711508-58758884 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58732321 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 203 (S203P)
Ref Sequence ENSEMBL: ENSMUSP00000109948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069333] [ENSMUST00000097722] [ENSMUST00000114309] [ENSMUST00000114313]
AlphaFold O35732
Predicted Effect probably benign
Transcript: ENSMUST00000069333
AA Change: S203P

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000065107
Gene: ENSMUSG00000026031
AA Change: S203P

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
CASc 245 480 6.05e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097722
SMART Domains Protein: ENSMUSP00000095329
Gene: ENSMUSG00000026031

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
CASc 248 483 6.05e-92 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114309
AA Change: S203P

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000109948
Gene: ENSMUSG00000026031
AA Change: S203P

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114313
AA Change: S203P

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000109952
Gene: ENSMUSG00000026031
AA Change: S203P

DomainStartEndE-ValueType
DED 6 78 8.94e-22 SMART
DED 96 175 4.33e-29 SMART
CASc 245 480 6.05e-92 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164900
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a regulator of apoptosis and is structurally similar to caspase-8. However, the encoded protein lacks caspase activity and appears to be itself cleaved into two peptides by caspase-8. Several transcript variants encoding different isoforms have been found for this gene, and partial evidence for several more variants exists. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality by E10.5. Mutant embryos exhibit cardiac developmental abnormalities and pooling of blood in the head and abdominal regions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,881,161 R490C probably benign Het
Abcb11 A T 2: 69,245,867 F1166I probably damaging Het
Acta2 T C 19: 34,246,152 D181G probably damaging Het
Adgrv1 A G 13: 81,106,919 I6195T probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankfy1 T G 11: 72,712,291 S49A probably benign Het
Azi2 A T 9: 118,061,471 probably benign Het
Bend3 A T 10: 43,510,750 S380C probably damaging Het
Bicc1 T C 10: 70,940,593 T759A probably damaging Het
Cdh10 G T 15: 19,013,278 V655L probably damaging Het
Cdkn2aip C A 8: 47,713,547 W75L probably damaging Het
Cenpj G A 14: 56,549,545 R192* probably null Het
Chd6 A T 2: 160,966,244 C1683* probably null Het
Cpsf2 A G 12: 101,997,440 Y476C probably damaging Het
Cyp4a12a A G 4: 115,326,191 D169G possibly damaging Het
D430041D05Rik T A 2: 104,214,096 R1536S probably damaging Het
Depdc5 A C 5: 32,937,635 D752A probably damaging Het
Dnah9 C T 11: 65,927,726 G78D probably damaging Het
Drc1 G T 5: 30,348,731 Q249H probably benign Het
Drg1 T C 11: 3,250,280 I364V probably benign Het
Dtymk T C 1: 93,792,909 H130R probably damaging Het
Elac2 T G 11: 64,992,222 F140V probably damaging Het
Enpp2 A G 15: 54,875,672 V353A possibly damaging Het
Fat2 T C 11: 55,281,187 D2900G probably damaging Het
Fermt2 G T 14: 45,462,236 T536K probably benign Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gadl1 A G 9: 115,966,313 K328R probably null Het
Gata6 A G 18: 11,054,394 T108A probably benign Het
Gm16503 G T 4: 147,541,097 G16V unknown Het
Gpr37 T G 6: 25,669,108 E579A probably damaging Het
Gps2 T C 11: 69,916,361 probably benign Het
Hcn4 A T 9: 58,857,977 I581F unknown Het
Hfm1 T A 5: 106,842,539 Y1335F probably benign Het
Igsf10 A T 3: 59,329,705 S1018R probably benign Het
Katnal2 C T 18: 76,977,543 probably null Het
Kctd8 T C 5: 69,340,848 K152E possibly damaging Het
Lrp8 T C 4: 107,854,395 C459R probably damaging Het
Ly6l A T 15: 75,449,694 I48L probably benign Het
Megf10 A T 18: 57,287,794 I835F possibly damaging Het
Mei1 A T 15: 82,112,485 I946F possibly damaging Het
Mkl2 C A 16: 13,412,594 P1048T probably damaging Het
Myo7b G C 18: 31,961,900 L1881V probably benign Het
Nfkbiz T C 16: 55,819,024 probably null Het
Olfr142 T A 2: 90,252,463 Y175F probably damaging Het
Olfr1449 T C 19: 12,935,076 C113R possibly damaging Het
Pcdhgc5 T C 18: 37,822,069 S799P probably benign Het
Plk4 A G 3: 40,802,022 E97G probably damaging Het
Pole2 A T 12: 69,222,052 H114Q possibly damaging Het
Rad9a C A 19: 4,200,489 V109L probably benign Het
Scn8a A G 15: 101,040,471 H1917R probably benign Het
Scyl2 C T 10: 89,659,298 V304I probably damaging Het
Serpina3f G C 12: 104,219,431 E298D probably benign Het
Shoc2 A G 19: 53,988,303 E208G probably benign Het
Sin3a G A 9: 57,096,803 V280I probably benign Het
Slc26a2 A T 18: 61,199,486 I291N probably damaging Het
Slc4a7 T G 14: 14,762,414 D600E probably damaging Het
Slc5a6 A T 5: 31,038,083 F430L possibly damaging Het
Snx19 A C 9: 30,440,157 Q840H probably damaging Het
Spast C A 17: 74,369,216 D340E probably damaging Het
Sprr4 G A 3: 92,500,409 P29S unknown Het
Stk11ip T G 1: 75,527,155 L239R probably damaging Het
Thoc6 A G 17: 23,670,888 L20P probably damaging Het
Tnfrsf8 A T 4: 145,296,877 S129T probably benign Het
Tnrc6c A G 11: 117,742,927 I1284V probably benign Het
Ttn A G 2: 76,710,987 L33885P probably damaging Het
Ttn T C 2: 76,772,507 Y16711C probably damaging Het
Ubn2 T A 6: 38,479,140 C501S probably damaging Het
Ubr1 A T 2: 120,963,442 L87* probably null Het
Uhmk1 T C 1: 170,199,901 Y320C probably damaging Het
Vldlr T C 19: 27,240,547 V465A probably damaging Het
Vmn1r1 C T 1: 182,157,906 A65T probably benign Het
Vmn2r25 C T 6: 123,823,223 C720Y probably damaging Het
Xrra1 T C 7: 99,906,568 Y381H probably benign Het
Zfhx4 T C 3: 5,400,152 L1790P probably benign Het
Zscan4d T A 7: 11,162,667 M259L probably benign Het
Other mutations in Cflar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Cflar APN 1 58732310 missense probably benign 0.42
IGL00959:Cflar APN 1 58729162 critical splice donor site probably null
IGL02045:Cflar APN 1 58752744 missense probably benign 0.25
IGL02200:Cflar APN 1 58752669 missense probably damaging 1.00
IGL02382:Cflar APN 1 58752681 missense probably benign 0.14
IGL03032:Cflar APN 1 58741020 missense probably damaging 1.00
Channel_islands UTSW 1 58753851 missense probably benign 0.00
IGL02988:Cflar UTSW 1 58741031 missense possibly damaging 0.58
R1936:Cflar UTSW 1 58752625 nonsense probably null
R2259:Cflar UTSW 1 58729121 missense probably benign 0.16
R2269:Cflar UTSW 1 58741047 critical splice donor site probably null
R3816:Cflar UTSW 1 58752423 missense probably benign 0.24
R3824:Cflar UTSW 1 58735697 missense probably benign 0.00
R4232:Cflar UTSW 1 58740993 missense possibly damaging 0.92
R4644:Cflar UTSW 1 58731267 missense probably damaging 1.00
R4749:Cflar UTSW 1 58740272 missense possibly damaging 0.62
R4785:Cflar UTSW 1 58752567 missense probably benign 0.34
R5315:Cflar UTSW 1 58753802 missense probably benign 0.34
R5418:Cflar UTSW 1 58752651 missense possibly damaging 0.54
R5509:Cflar UTSW 1 58752392 missense probably benign 0.02
R5858:Cflar UTSW 1 58753851 missense probably benign 0.00
R5899:Cflar UTSW 1 58752768 missense probably benign 0.36
R6048:Cflar UTSW 1 58741043 missense probably benign 0.02
R7065:Cflar UTSW 1 58731209 missense probably damaging 1.00
R7144:Cflar UTSW 1 58753848 missense
R7206:Cflar UTSW 1 58740991 missense
R7384:Cflar UTSW 1 58752576 missense
R7453:Cflar UTSW 1 58753797 missense
R7467:Cflar UTSW 1 58726438 start codon destroyed probably null
R7694:Cflar UTSW 1 58752807 missense
R7808:Cflar UTSW 1 58711581 start gained probably benign
R7890:Cflar UTSW 1 58752756 missense
R8073:Cflar UTSW 1 58752822 missense
R9506:Cflar UTSW 1 58752816 missense
Z1176:Cflar UTSW 1 58731229 missense
Z1176:Cflar UTSW 1 58740313 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGGTTTAAGGTGTTTTGAAAGACG -3'
(R):5'- TCCACAGTAGTCATGCCCAG -3'

Sequencing Primer
(F):5'- TTTTGAAAGACGACGGTTGAC -3'
(R):5'- ACAGTAGTCATGCCCAGATAATG -3'
Posted On 2015-12-21