Incidental Mutation 'R4765:Abcb11'
ID 366034
Institutional Source Beutler Lab
Gene Symbol Abcb11
Ensembl Gene ENSMUSG00000027048
Gene Name ATP-binding cassette, sub-family B (MDR/TAP), member 11
Synonyms PFIC2, Bsep, PGY4, Lith1, ABC16, sister of P-glycoprotein
MMRRC Submission 042406-MU
Accession Numbers

Genbank: NM_021022; MGI: 1351619

Is this an essential gene? Possibly essential (E-score: 0.643) question?
Stock # R4765 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 69238282-69342616 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 69245867 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1166 (F1166I)
Ref Sequence ENSEMBL: ENSMUSP00000137017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102709] [ENSMUST00000102710] [ENSMUST00000180142]
AlphaFold Q9QY30
Predicted Effect probably damaging
Transcript: ENSMUST00000102709
AA Change: F1166I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099770
Gene: ENSMUSG00000027048
AA Change: F1166I

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 373 1.3e-65 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1031 2.7e-55 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102710
AA Change: F1166I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099771
Gene: ENSMUSG00000027048
AA Change: F1166I

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.7e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 3.2e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126240
Predicted Effect probably damaging
Transcript: ENSMUST00000180142
AA Change: F1166I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137017
Gene: ENSMUSG00000027048
AA Change: F1166I

DomainStartEndE-ValueType
Pfam:ABC_membrane 62 371 1.4e-72 PFAM
AAA 447 639 1.65e-17 SMART
Pfam:ABC_membrane 755 1029 2.5e-59 PFAM
AAA 1105 1299 1.9e-17 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is the major canalicular bile salt transporter in humans and mice. Mutations in the human gene cause a form of progressive familial intrahepatic cholestases which are a group of inherited disorders with severe cholestatic liver disease from early infancy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display intrahepatic cholestasis. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,881,161 R490C probably benign Het
Acta2 T C 19: 34,246,152 D181G probably damaging Het
Adgrv1 A G 13: 81,106,919 I6195T probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankfy1 T G 11: 72,712,291 S49A probably benign Het
Azi2 A T 9: 118,061,471 probably benign Het
Bend3 A T 10: 43,510,750 S380C probably damaging Het
Bicc1 T C 10: 70,940,593 T759A probably damaging Het
Cdh10 G T 15: 19,013,278 V655L probably damaging Het
Cdkn2aip C A 8: 47,713,547 W75L probably damaging Het
Cenpj G A 14: 56,549,545 R192* probably null Het
Cflar T C 1: 58,732,321 S203P probably damaging Het
Chd6 A T 2: 160,966,244 C1683* probably null Het
Cpsf2 A G 12: 101,997,440 Y476C probably damaging Het
Cyp4a12a A G 4: 115,326,191 D169G possibly damaging Het
D430041D05Rik T A 2: 104,214,096 R1536S probably damaging Het
Depdc5 A C 5: 32,937,635 D752A probably damaging Het
Dnah9 C T 11: 65,927,726 G78D probably damaging Het
Drc1 G T 5: 30,348,731 Q249H probably benign Het
Drg1 T C 11: 3,250,280 I364V probably benign Het
Dtymk T C 1: 93,792,909 H130R probably damaging Het
Elac2 T G 11: 64,992,222 F140V probably damaging Het
Enpp2 A G 15: 54,875,672 V353A possibly damaging Het
Fat2 T C 11: 55,281,187 D2900G probably damaging Het
Fermt2 G T 14: 45,462,236 T536K probably benign Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gadl1 A G 9: 115,966,313 K328R probably null Het
Gata6 A G 18: 11,054,394 T108A probably benign Het
Gm16503 G T 4: 147,541,097 G16V unknown Het
Gpr37 T G 6: 25,669,108 E579A probably damaging Het
Gps2 T C 11: 69,916,361 probably benign Het
Hcn4 A T 9: 58,857,977 I581F unknown Het
Hfm1 T A 5: 106,842,539 Y1335F probably benign Het
Igsf10 A T 3: 59,329,705 S1018R probably benign Het
Katnal2 C T 18: 76,977,543 probably null Het
Kctd8 T C 5: 69,340,848 K152E possibly damaging Het
Lrp8 T C 4: 107,854,395 C459R probably damaging Het
Ly6l A T 15: 75,449,694 I48L probably benign Het
Megf10 A T 18: 57,287,794 I835F possibly damaging Het
Mei1 A T 15: 82,112,485 I946F possibly damaging Het
Mkl2 C A 16: 13,412,594 P1048T probably damaging Het
Myo7b G C 18: 31,961,900 L1881V probably benign Het
Nfkbiz T C 16: 55,819,024 probably null Het
Olfr142 T A 2: 90,252,463 Y175F probably damaging Het
Olfr1449 T C 19: 12,935,076 C113R possibly damaging Het
Pcdhgc5 T C 18: 37,822,069 S799P probably benign Het
Plk4 A G 3: 40,802,022 E97G probably damaging Het
Pole2 A T 12: 69,222,052 H114Q possibly damaging Het
Rad9a C A 19: 4,200,489 V109L probably benign Het
Scn8a A G 15: 101,040,471 H1917R probably benign Het
Scyl2 C T 10: 89,659,298 V304I probably damaging Het
Serpina3f G C 12: 104,219,431 E298D probably benign Het
Shoc2 A G 19: 53,988,303 E208G probably benign Het
Sin3a G A 9: 57,096,803 V280I probably benign Het
Slc26a2 A T 18: 61,199,486 I291N probably damaging Het
Slc4a7 T G 14: 14,762,414 D600E probably damaging Het
Slc5a6 A T 5: 31,038,083 F430L possibly damaging Het
Snx19 A C 9: 30,440,157 Q840H probably damaging Het
Spast C A 17: 74,369,216 D340E probably damaging Het
Sprr4 G A 3: 92,500,409 P29S unknown Het
Stk11ip T G 1: 75,527,155 L239R probably damaging Het
Thoc6 A G 17: 23,670,888 L20P probably damaging Het
Tnfrsf8 A T 4: 145,296,877 S129T probably benign Het
Tnrc6c A G 11: 117,742,927 I1284V probably benign Het
Ttn A G 2: 76,710,987 L33885P probably damaging Het
Ttn T C 2: 76,772,507 Y16711C probably damaging Het
Ubn2 T A 6: 38,479,140 C501S probably damaging Het
Ubr1 A T 2: 120,963,442 L87* probably null Het
Uhmk1 T C 1: 170,199,901 Y320C probably damaging Het
Vldlr T C 19: 27,240,547 V465A probably damaging Het
Vmn1r1 C T 1: 182,157,906 A65T probably benign Het
Vmn2r25 C T 6: 123,823,223 C720Y probably damaging Het
Xrra1 T C 7: 99,906,568 Y381H probably benign Het
Zfhx4 T C 3: 5,400,152 L1790P probably benign Het
Zscan4d T A 7: 11,162,667 M259L probably benign Het
Other mutations in Abcb11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Abcb11 APN 2 69284681 missense possibly damaging 0.90
IGL01407:Abcb11 APN 2 69245944 missense probably damaging 1.00
IGL01583:Abcb11 APN 2 69296409 missense possibly damaging 0.81
IGL01813:Abcb11 APN 2 69287592 splice site probably benign
IGL01885:Abcb11 APN 2 69287627 missense probably damaging 1.00
IGL01937:Abcb11 APN 2 69287612 missense probably damaging 1.00
IGL02058:Abcb11 APN 2 69243498 missense probably damaging 0.98
IGL02117:Abcb11 APN 2 69323825 splice site probably benign
IGL02119:Abcb11 APN 2 69328000 critical splice acceptor site probably null
IGL02120:Abcb11 APN 2 69257310 missense probably damaging 1.00
IGL02158:Abcb11 APN 2 69299925 missense probably damaging 0.96
IGL02212:Abcb11 APN 2 69248889 missense probably damaging 0.97
IGL02306:Abcb11 APN 2 69265457 nonsense probably null
IGL02505:Abcb11 APN 2 69245761 missense probably damaging 1.00
IGL02538:Abcb11 APN 2 69306605 missense possibly damaging 0.67
IGL02793:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL02863:Abcb11 APN 2 69284682 missense probably damaging 0.99
IGL02875:Abcb11 APN 2 69291949 missense possibly damaging 0.90
IGL03164:Abcb11 APN 2 69291999 nonsense probably null
IGL03181:Abcb11 APN 2 69328008 intron probably benign
3-1:Abcb11 UTSW 2 69327993 missense probably benign 0.00
FR4737:Abcb11 UTSW 2 69243518 missense probably damaging 0.97
R0031:Abcb11 UTSW 2 69285308 missense probably damaging 1.00
R0398:Abcb11 UTSW 2 69286666 missense probably null 0.82
R0413:Abcb11 UTSW 2 69328011 intron probably benign
R0437:Abcb11 UTSW 2 69257295 missense probably damaging 1.00
R0496:Abcb11 UTSW 2 69277884 splice site probably benign
R0646:Abcb11 UTSW 2 69285283 missense probably damaging 1.00
R0669:Abcb11 UTSW 2 69329318 missense probably benign 0.15
R0856:Abcb11 UTSW 2 69323918 missense probably benign
R1061:Abcb11 UTSW 2 69277809 missense probably benign 0.00
R1460:Abcb11 UTSW 2 69257374 splice site probably benign
R1714:Abcb11 UTSW 2 69306581 missense probably damaging 0.99
R1739:Abcb11 UTSW 2 69261566 missense probably damaging 1.00
R1856:Abcb11 UTSW 2 69245923 missense probably damaging 1.00
R1994:Abcb11 UTSW 2 69282670 splice site probably null
R2086:Abcb11 UTSW 2 69259476 splice site probably benign
R2133:Abcb11 UTSW 2 69323883 missense possibly damaging 0.65
R2516:Abcb11 UTSW 2 69329329 missense possibly damaging 0.88
R2930:Abcb11 UTSW 2 69257358 missense probably damaging 0.96
R3771:Abcb11 UTSW 2 69329376 splice site probably benign
R3772:Abcb11 UTSW 2 69329376 splice site probably benign
R3979:Abcb11 UTSW 2 69323976 missense probably benign 0.11
R4227:Abcb11 UTSW 2 69284776 missense probably damaging 1.00
R4255:Abcb11 UTSW 2 69306605 missense probably benign 0.03
R4614:Abcb11 UTSW 2 69284681 missense possibly damaging 0.90
R4647:Abcb11 UTSW 2 69285271 missense probably damaging 1.00
R4719:Abcb11 UTSW 2 69259627 missense probably damaging 1.00
R4734:Abcb11 UTSW 2 69323962 missense possibly damaging 0.73
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4861:Abcb11 UTSW 2 69245905 missense probably damaging 1.00
R4870:Abcb11 UTSW 2 69239196 missense probably damaging 0.99
R4988:Abcb11 UTSW 2 69323892 missense probably benign 0.12
R5028:Abcb11 UTSW 2 69274012 missense probably damaging 1.00
R5048:Abcb11 UTSW 2 69308506 missense probably benign 0.06
R5177:Abcb11 UTSW 2 69285295 missense probably damaging 1.00
R5301:Abcb11 UTSW 2 69286847 missense probably damaging 0.98
R5789:Abcb11 UTSW 2 69245764 missense probably damaging 1.00
R5892:Abcb11 UTSW 2 69261500 missense probably damaging 0.99
R6003:Abcb11 UTSW 2 69243467 missense probably benign 0.43
R6252:Abcb11 UTSW 2 69291961 missense probably benign 0.10
R6389:Abcb11 UTSW 2 69323894 missense probably damaging 1.00
R6512:Abcb11 UTSW 2 69282652 missense probably benign
R6590:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6690:Abcb11 UTSW 2 69284718 missense probably damaging 1.00
R6732:Abcb11 UTSW 2 69286846 missense probably damaging 1.00
R6870:Abcb11 UTSW 2 69285298 missense possibly damaging 0.91
R7028:Abcb11 UTSW 2 69265675 missense probably benign
R7223:Abcb11 UTSW 2 69274143 missense probably benign
R7323:Abcb11 UTSW 2 69287635 missense probably damaging 1.00
R7337:Abcb11 UTSW 2 69245769 missense probably damaging 1.00
R7339:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7340:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7341:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7343:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7366:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7393:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7394:Abcb11 UTSW 2 69299867 missense probably damaging 0.99
R7405:Abcb11 UTSW 2 69287619 missense probably damaging 1.00
R7411:Abcb11 UTSW 2 69303936 critical splice donor site probably null
R7488:Abcb11 UTSW 2 69277802 missense probably benign
R7544:Abcb11 UTSW 2 69265486 missense probably benign 0.05
R7660:Abcb11 UTSW 2 69287594 splice site probably null
R7754:Abcb11 UTSW 2 69286818 missense probably damaging 1.00
R7771:Abcb11 UTSW 2 69239191 missense probably damaging 0.99
R7794:Abcb11 UTSW 2 69286678 missense possibly damaging 0.62
R7834:Abcb11 UTSW 2 69284724 missense probably damaging 1.00
R7897:Abcb11 UTSW 2 69323872 frame shift probably null
R7897:Abcb11 UTSW 2 69323873 small deletion probably benign
R7937:Abcb11 UTSW 2 69323873 small deletion probably benign
R8004:Abcb11 UTSW 2 69257210 missense possibly damaging 0.68
R8089:Abcb11 UTSW 2 69274039 missense probably benign 0.09
R8279:Abcb11 UTSW 2 69239205 missense probably benign 0.05
R8426:Abcb11 UTSW 2 69325262 missense probably benign
R8441:Abcb11 UTSW 2 69257230 missense possibly damaging 0.93
R8460:Abcb11 UTSW 2 69324037 missense possibly damaging 0.70
R8462:Abcb11 UTSW 2 69274155 missense probably benign
R8532:Abcb11 UTSW 2 69259691 missense possibly damaging 0.69
R8534:Abcb11 UTSW 2 69323846 missense possibly damaging 0.89
R8711:Abcb11 UTSW 2 69265512 missense probably damaging 1.00
R8746:Abcb11 UTSW 2 69257410 intron probably benign
R8964:Abcb11 UTSW 2 69286717 missense possibly damaging 0.52
R8990:Abcb11 UTSW 2 69274150 missense
R9081:Abcb11 UTSW 2 69292044 missense possibly damaging 0.59
R9093:Abcb11 UTSW 2 69239169 missense probably damaging 0.97
R9228:Abcb11 UTSW 2 69308465 nonsense probably null
R9294:Abcb11 UTSW 2 69265496 missense possibly damaging 0.89
X0058:Abcb11 UTSW 2 69289443 missense probably benign 0.12
X0062:Abcb11 UTSW 2 69245906 missense probably damaging 1.00
X0065:Abcb11 UTSW 2 69299866 missense probably damaging 0.99
Z1176:Abcb11 UTSW 2 69291981 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69306529 missense probably damaging 1.00
Z1177:Abcb11 UTSW 2 69329269 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTAGTATCCCACGCCTCCACAG -3'
(R):5'- CAGGCAGTGTGATTGATGTCC -3'

Sequencing Primer
(F):5'- CAGCCCTGTGTTGTTCTGTAAAGAAC -3'
(R):5'- GGGGATGTTCATTCTTAAACAGATGC -3'
Posted On 2015-12-21