Incidental Mutation 'R4765:Or4b13'
ID 366037
Institutional Source Beutler Lab
Gene Symbol Or4b13
Ensembl Gene ENSMUSG00000075063
Gene Name olfactory receptor family 4 subfamily B member 13
Synonyms K20, Olfr142, GA_x6K02T2Q125-51607674-51606757, MOR227-2
MMRRC Submission 042406-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R4765 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 90082413-90083330 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 90082807 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 175 (Y175F)
Ref Sequence ENSEMBL: ENSMUSP00000150216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099752] [ENSMUST00000213968]
AlphaFold Q60881
Predicted Effect probably damaging
Transcript: ENSMUST00000099752
AA Change: Y175F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097341
Gene: ENSMUSG00000075063
AA Change: Y175F

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 4.3e-53 PFAM
Pfam:7TM_GPCR_Srsx 33 300 3e-6 PFAM
Pfam:7tm_1 39 285 5.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213968
AA Change: Y175F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,771,987 (GRCm39) R490C probably benign Het
Abcb11 A T 2: 69,076,211 (GRCm39) F1166I probably damaging Het
Acta2 T C 19: 34,223,552 (GRCm39) D181G probably damaging Het
Adgrv1 A G 13: 81,255,038 (GRCm39) I6195T probably damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Ankfy1 T G 11: 72,603,117 (GRCm39) S49A probably benign Het
Azi2 A T 9: 117,890,539 (GRCm39) probably benign Het
Bend3 A T 10: 43,386,746 (GRCm39) S380C probably damaging Het
Bicc1 T C 10: 70,776,423 (GRCm39) T759A probably damaging Het
Cdh10 G T 15: 19,013,364 (GRCm39) V655L probably damaging Het
Cdkn2aip C A 8: 48,166,582 (GRCm39) W75L probably damaging Het
Cenpj G A 14: 56,787,002 (GRCm39) R192* probably null Het
Cflar T C 1: 58,771,480 (GRCm39) S203P probably damaging Het
Chd6 A T 2: 160,808,164 (GRCm39) C1683* probably null Het
Cpsf2 A G 12: 101,963,699 (GRCm39) Y476C probably damaging Het
Cyp4a12a A G 4: 115,183,388 (GRCm39) D169G possibly damaging Het
D430041D05Rik T A 2: 104,044,441 (GRCm39) R1536S probably damaging Het
Depdc5 A C 5: 33,094,979 (GRCm39) D752A probably damaging Het
Dnah9 C T 11: 65,818,552 (GRCm39) G78D probably damaging Het
Drc1 G T 5: 30,506,075 (GRCm39) Q249H probably benign Het
Drg1 T C 11: 3,200,280 (GRCm39) I364V probably benign Het
Dtymk T C 1: 93,720,631 (GRCm39) H130R probably damaging Het
Elac2 T G 11: 64,883,048 (GRCm39) F140V probably damaging Het
Enpp2 A G 15: 54,739,068 (GRCm39) V353A possibly damaging Het
Fat2 T C 11: 55,172,013 (GRCm39) D2900G probably damaging Het
Fermt2 G T 14: 45,699,693 (GRCm39) T536K probably benign Het
Foxj2 G T 6: 122,810,230 (GRCm39) Q196H probably benign Het
Gadl1 A G 9: 115,795,381 (GRCm39) K328R probably null Het
Gata6 A G 18: 11,054,394 (GRCm39) T108A probably benign Het
Gm16503 G T 4: 147,625,554 (GRCm39) G16V unknown Het
Gpr37 T G 6: 25,669,107 (GRCm39) E579A probably damaging Het
Gps2 T C 11: 69,807,187 (GRCm39) probably benign Het
Hcn4 A T 9: 58,765,260 (GRCm39) I581F unknown Het
Hfm1 T A 5: 106,990,405 (GRCm39) Y1335F probably benign Het
Igsf10 A T 3: 59,237,126 (GRCm39) S1018R probably benign Het
Katnal2 C T 18: 77,065,239 (GRCm39) probably null Het
Kctd8 T C 5: 69,498,191 (GRCm39) K152E possibly damaging Het
Lrp8 T C 4: 107,711,592 (GRCm39) C459R probably damaging Het
Ly6l A T 15: 75,321,543 (GRCm39) I48L probably benign Het
Megf10 A T 18: 57,420,866 (GRCm39) I835F possibly damaging Het
Mei1 A T 15: 81,996,686 (GRCm39) I946F possibly damaging Het
Mrtfb C A 16: 13,230,458 (GRCm39) P1048T probably damaging Het
Myo7b G C 18: 32,094,953 (GRCm39) L1881V probably benign Het
Nfkbiz T C 16: 55,639,387 (GRCm39) probably null Het
Or5b24 T C 19: 12,912,440 (GRCm39) C113R possibly damaging Het
Pcdhgc5 T C 18: 37,955,122 (GRCm39) S799P probably benign Het
Plk4 A G 3: 40,756,457 (GRCm39) E97G probably damaging Het
Pole2 A T 12: 69,268,826 (GRCm39) H114Q possibly damaging Het
Rad9a C A 19: 4,250,488 (GRCm39) V109L probably benign Het
Scn8a A G 15: 100,938,352 (GRCm39) H1917R probably benign Het
Scyl2 C T 10: 89,495,160 (GRCm39) V304I probably damaging Het
Serpina3f G C 12: 104,185,690 (GRCm39) E298D probably benign Het
Shoc2 A G 19: 53,976,734 (GRCm39) E208G probably benign Het
Sin3a G A 9: 57,004,087 (GRCm39) V280I probably benign Het
Slc26a2 A T 18: 61,332,558 (GRCm39) I291N probably damaging Het
Slc4a7 T G 14: 14,762,414 (GRCm38) D600E probably damaging Het
Slc5a6 A T 5: 31,195,427 (GRCm39) F430L possibly damaging Het
Snx19 A C 9: 30,351,453 (GRCm39) Q840H probably damaging Het
Spast C A 17: 74,676,211 (GRCm39) D340E probably damaging Het
Sprr4 G A 3: 92,407,716 (GRCm39) P29S unknown Het
Stk11ip T G 1: 75,503,799 (GRCm39) L239R probably damaging Het
Thoc6 A G 17: 23,889,862 (GRCm39) L20P probably damaging Het
Tnfrsf8 A T 4: 145,023,447 (GRCm39) S129T probably benign Het
Tnrc6c A G 11: 117,633,753 (GRCm39) I1284V probably benign Het
Ttn T C 2: 76,602,851 (GRCm39) Y16711C probably damaging Het
Ttn A G 2: 76,541,331 (GRCm39) L33885P probably damaging Het
Ubn2 T A 6: 38,456,075 (GRCm39) C501S probably damaging Het
Ubr1 A T 2: 120,793,923 (GRCm39) L87* probably null Het
Uhmk1 T C 1: 170,027,470 (GRCm39) Y320C probably damaging Het
Vldlr T C 19: 27,217,947 (GRCm39) V465A probably damaging Het
Vmn1r1 C T 1: 181,985,471 (GRCm39) A65T probably benign Het
Vmn2r25 C T 6: 123,800,182 (GRCm39) C720Y probably damaging Het
Xrra1 T C 7: 99,555,775 (GRCm39) Y381H probably benign Het
Zfhx4 T C 3: 5,465,212 (GRCm39) L1790P probably benign Het
Zscan4d T A 7: 10,896,594 (GRCm39) M259L probably benign Het
Other mutations in Or4b13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:Or4b13 APN 2 90,082,953 (GRCm39) missense probably damaging 1.00
IGL01623:Or4b13 APN 2 90,082,953 (GRCm39) missense probably damaging 1.00
IGL01810:Or4b13 APN 2 90,082,476 (GRCm39) nonsense probably null
IGL01918:Or4b13 APN 2 90,082,675 (GRCm39) missense probably damaging 1.00
IGL02619:Or4b13 APN 2 90,082,849 (GRCm39) missense probably damaging 0.97
IGL02732:Or4b13 APN 2 90,082,652 (GRCm39) missense probably damaging 1.00
IGL02738:Or4b13 APN 2 90,082,699 (GRCm39) missense possibly damaging 0.82
IGL02795:Or4b13 APN 2 90,082,906 (GRCm39) missense probably damaging 1.00
IGL02830:Or4b13 APN 2 90,083,125 (GRCm39) missense probably damaging 1.00
R0601:Or4b13 UTSW 2 90,083,278 (GRCm39) missense probably benign 0.05
R2004:Or4b13 UTSW 2 90,083,036 (GRCm39) missense probably benign 0.04
R2136:Or4b13 UTSW 2 90,082,597 (GRCm39) missense probably damaging 0.98
R2377:Or4b13 UTSW 2 90,083,255 (GRCm39) missense probably damaging 1.00
R3615:Or4b13 UTSW 2 90,082,753 (GRCm39) missense possibly damaging 0.94
R3616:Or4b13 UTSW 2 90,082,753 (GRCm39) missense possibly damaging 0.94
R3777:Or4b13 UTSW 2 90,082,969 (GRCm39) missense probably damaging 1.00
R4763:Or4b13 UTSW 2 90,082,807 (GRCm39) missense probably damaging 1.00
R5421:Or4b13 UTSW 2 90,083,089 (GRCm39) missense probably benign 0.01
R5426:Or4b13 UTSW 2 90,082,955 (GRCm39) nonsense probably null
R6063:Or4b13 UTSW 2 90,082,771 (GRCm39) missense probably benign 0.40
R6717:Or4b13 UTSW 2 90,082,868 (GRCm39) missense probably benign 0.00
R6931:Or4b13 UTSW 2 90,083,121 (GRCm39) nonsense probably null
R6936:Or4b13 UTSW 2 90,082,678 (GRCm39) missense probably benign 0.17
R7013:Or4b13 UTSW 2 90,082,441 (GRCm39) missense possibly damaging 0.87
R7091:Or4b13 UTSW 2 90,082,807 (GRCm39) missense probably damaging 1.00
R7247:Or4b13 UTSW 2 90,083,165 (GRCm39) missense probably damaging 1.00
R8169:Or4b13 UTSW 2 90,082,442 (GRCm39) nonsense probably null
R8345:Or4b13 UTSW 2 90,082,561 (GRCm39) missense possibly damaging 0.50
R9222:Or4b13 UTSW 2 90,082,820 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GAACAGGATGACCACTGTGATG -3'
(R):5'- GATGGCCTATGACCGCTATGTG -3'

Sequencing Primer
(F):5'- CCACTGTGATGTGAGAGGC -3'
(R):5'- GCTATGTGGCCATCTGCAAAC -3'
Posted On 2015-12-21