Mutagenetix > Incidental Mutations

Incidental Mutation 'R4765:Ubr1'

366039

Institutional Source

Beutler Lab

Gene Symbol

Ubr1

Ensembl Gene

ENSMUSG00000027272

Gene Name

ubiquitin protein ligase E3 component n-recognin 1

Synonyms

E3 alpha

MMRRC Submission

042406-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.851) question?

Stock #

R4765 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

120860269-120970715 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 120963442 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 87 (L87*)

Ref Sequence

ENSEMBL: ENSMUSP00000028728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028728]

AlphaFold

O70481

Predicted Effect

probably null
Transcript: ENSMUST00000028728
AA Change: L87*

SMART Domains

Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: L87*

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	1.24e-35	SMART
Pfam:ClpS	221	301	8e-24	PFAM
low complexity region	918	936	N/A	INTRINSIC
low complexity region	1017	1030	N/A	INTRINSIC
low complexity region	1070	1081	N/A	INTRINSIC
Blast:RING	1101	1203	4e-34	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133408

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138824

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	C	T	11: 58,881,161	R490C	probably benign	Het
Abcb11	A	T	2: 69,245,867	F1166I	probably damaging	Het
Acta2	T	C	19: 34,246,152	D181G	probably damaging	Het
Adgrv1	A	G	13: 81,106,919	I6195T	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ankfy1	T	G	11: 72,712,291	S49A	probably benign	Het
Azi2	A	T	9: 118,061,471		probably benign	Het
Bend3	A	T	10: 43,510,750	S380C	probably damaging	Het
Bicc1	T	C	10: 70,940,593	T759A	probably damaging	Het
Cdh10	G	T	15: 19,013,278	V655L	probably damaging	Het
Cdkn2aip	C	A	8: 47,713,547	W75L	probably damaging	Het
Cenpj	G	A	14: 56,549,545	R192*	probably null	Het
Cflar	T	C	1: 58,732,321	S203P	probably damaging	Het
Chd6	A	T	2: 160,966,244	C1683*	probably null	Het
Cpsf2	A	G	12: 101,997,440	Y476C	probably damaging	Het
Cyp4a12a	A	G	4: 115,326,191	D169G	possibly damaging	Het
D430041D05Rik	T	A	2: 104,214,096	R1536S	probably damaging	Het
Depdc5	A	C	5: 32,937,635	D752A	probably damaging	Het
Dnah9	C	T	11: 65,927,726	G78D	probably damaging	Het
Drc1	G	T	5: 30,348,731	Q249H	probably benign	Het
Drg1	T	C	11: 3,250,280	I364V	probably benign	Het
Dtymk	T	C	1: 93,792,909	H130R	probably damaging	Het
Elac2	T	G	11: 64,992,222	F140V	probably damaging	Het
Enpp2	A	G	15: 54,875,672	V353A	possibly damaging	Het
Fat2	T	C	11: 55,281,187	D2900G	probably damaging	Het
Fermt2	G	T	14: 45,462,236	T536K	probably benign	Het
Foxj2	G	T	6: 122,833,271	Q196H	probably benign	Het
Gadl1	A	G	9: 115,966,313	K328R	probably null	Het
Gata6	A	G	18: 11,054,394	T108A	probably benign	Het
Gm16503	G	T	4: 147,541,097	G16V	unknown	Het
Gpr37	T	G	6: 25,669,108	E579A	probably damaging	Het
Gps2	T	C	11: 69,916,361		probably benign	Het
Hcn4	A	T	9: 58,857,977	I581F	unknown	Het
Hfm1	T	A	5: 106,842,539	Y1335F	probably benign	Het
Igsf10	A	T	3: 59,329,705	S1018R	probably benign	Het
Katnal2	C	T	18: 76,977,543		probably null	Het
Kctd8	T	C	5: 69,340,848	K152E	possibly damaging	Het
Lrp8	T	C	4: 107,854,395	C459R	probably damaging	Het
Ly6l	A	T	15: 75,449,694	I48L	probably benign	Het
Megf10	A	T	18: 57,287,794	I835F	possibly damaging	Het
Mei1	A	T	15: 82,112,485	I946F	possibly damaging	Het
Mkl2	C	A	16: 13,412,594	P1048T	probably damaging	Het
Myo7b	G	C	18: 31,961,900	L1881V	probably benign	Het
Nfkbiz	T	C	16: 55,819,024		probably null	Het
Olfr142	T	A	2: 90,252,463	Y175F	probably damaging	Het
Olfr1449	T	C	19: 12,935,076	C113R	possibly damaging	Het
Pcdhgc5	T	C	18: 37,822,069	S799P	probably benign	Het
Plk4	A	G	3: 40,802,022	E97G	probably damaging	Het
Pole2	A	T	12: 69,222,052	H114Q	possibly damaging	Het
Rad9a	C	A	19: 4,200,489	V109L	probably benign	Het
Scn8a	A	G	15: 101,040,471	H1917R	probably benign	Het
Scyl2	C	T	10: 89,659,298	V304I	probably damaging	Het
Serpina3f	G	C	12: 104,219,431	E298D	probably benign	Het
Shoc2	A	G	19: 53,988,303	E208G	probably benign	Het
Sin3a	G	A	9: 57,096,803	V280I	probably benign	Het
Slc26a2	A	T	18: 61,199,486	I291N	probably damaging	Het
Slc4a7	T	G	14: 14,762,414	D600E	probably damaging	Het
Slc5a6	A	T	5: 31,038,083	F430L	possibly damaging	Het
Snx19	A	C	9: 30,440,157	Q840H	probably damaging	Het
Spast	C	A	17: 74,369,216	D340E	probably damaging	Het
Sprr4	G	A	3: 92,500,409	P29S	unknown	Het
Stk11ip	T	G	1: 75,527,155	L239R	probably damaging	Het
Thoc6	A	G	17: 23,670,888	L20P	probably damaging	Het
Tnfrsf8	A	T	4: 145,296,877	S129T	probably benign	Het
Tnrc6c	A	G	11: 117,742,927	I1284V	probably benign	Het
Ttn	A	G	2: 76,710,987	L33885P	probably damaging	Het
Ttn	T	C	2: 76,772,507	Y16711C	probably damaging	Het
Ubn2	T	A	6: 38,479,140	C501S	probably damaging	Het
Uhmk1	T	C	1: 170,199,901	Y320C	probably damaging	Het
Vldlr	T	C	19: 27,240,547	V465A	probably damaging	Het
Vmn1r1	C	T	1: 182,157,906	A65T	probably benign	Het
Vmn2r25	C	T	6: 123,823,223	C720Y	probably damaging	Het
Xrra1	T	C	7: 99,906,568	Y381H	probably benign	Het
Zfhx4	T	C	3: 5,400,152	L1790P	probably benign	Het
Zscan4d	T	A	7: 11,162,667	M259L	probably benign	Het

Other mutations in Ubr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Ubr1	APN	2	120875407	missense	possibly damaging	0.65
IGL00570:Ubr1	APN	2	120941093	missense	possibly damaging	0.93
IGL00990:Ubr1	APN	2	120930872	missense	probably damaging	1.00
IGL01124:Ubr1	APN	2	120914905	missense	probably benign
IGL01346:Ubr1	APN	2	120873122	critical splice donor site	probably null
IGL01368:Ubr1	APN	2	120941131	splice site	probably benign
IGL01539:Ubr1	APN	2	120926013	missense	possibly damaging	0.79
IGL01862:Ubr1	APN	2	120934342	missense	possibly damaging	0.81
IGL01965:Ubr1	APN	2	120875398	missense	probably damaging	0.99
IGL01984:Ubr1	APN	2	120921386	missense	probably damaging	0.99
IGL02184:Ubr1	APN	2	120900508	missense	probably benign	0.00
IGL02208:Ubr1	APN	2	120946349	missense	probably benign	0.00
IGL02415:Ubr1	APN	2	120970603	utr 5 prime	probably benign
IGL02517:Ubr1	APN	2	120864373	missense	possibly damaging	0.69
IGL02614:Ubr1	APN	2	120870979	splice site	probably benign
IGL02627:Ubr1	APN	2	120940991	missense	probably damaging	1.00
IGL02718:Ubr1	APN	2	120914883	missense	probably damaging	1.00
IGL02741:Ubr1	APN	2	120941091	missense	probably benign	0.01
IGL02939:Ubr1	APN	2	120881183	critical splice acceptor site	probably null
IGL03081:Ubr1	APN	2	120961156	missense	possibly damaging	0.83
IGL03310:Ubr1	APN	2	120864417	missense	probably damaging	1.00
IGL03370:Ubr1	APN	2	120895160	missense	probably benign
I1329:Ubr1	UTSW	2	120934294	splice site	probably benign
R0022:Ubr1	UTSW	2	120961173	splice site	probably benign
R0345:Ubr1	UTSW	2	120904103	splice site	probably null
R0373:Ubr1	UTSW	2	120946657	missense	probably benign	0.01
R0393:Ubr1	UTSW	2	120906946	missense	probably damaging	1.00
R0543:Ubr1	UTSW	2	120881093	missense	probably damaging	1.00
R0559:Ubr1	UTSW	2	120947883	nonsense	probably null
R0723:Ubr1	UTSW	2	120881101	nonsense	probably null
R1178:Ubr1	UTSW	2	120926029	nonsense	probably null
R1401:Ubr1	UTSW	2	120955644	missense	probably benign	0.01
R1485:Ubr1	UTSW	2	120961098	missense	probably benign	0.03
R1572:Ubr1	UTSW	2	120935319	splice site	probably benign
R1920:Ubr1	UTSW	2	120930968	missense	probably benign	0.11
R1921:Ubr1	UTSW	2	120930968	missense	probably benign	0.11
R1997:Ubr1	UTSW	2	120946273	critical splice donor site	probably null
R2129:Ubr1	UTSW	2	120942553	missense	probably benign	0.35
R2147:Ubr1	UTSW	2	120864330	missense	probably damaging	1.00
R2191:Ubr1	UTSW	2	120926047	missense	probably damaging	0.96
R2288:Ubr1	UTSW	2	120909482	missense	probably damaging	1.00
R3409:Ubr1	UTSW	2	120963448	missense	probably benign	0.02
R3930:Ubr1	UTSW	2	120916470	missense	probably benign	0.20
R3979:Ubr1	UTSW	2	120862687	missense	probably benign	0.11
R4172:Ubr1	UTSW	2	120946622	splice site	probably null
R4173:Ubr1	UTSW	2	120946622	splice site	probably null
R4174:Ubr1	UTSW	2	120946622	splice site	probably null
R4241:Ubr1	UTSW	2	120934386	missense	possibly damaging	0.69
R4366:Ubr1	UTSW	2	120970603	utr 5 prime	probably benign
R4371:Ubr1	UTSW	2	120895066	splice site	probably null
R4449:Ubr1	UTSW	2	120946381	missense	possibly damaging	0.84
R4533:Ubr1	UTSW	2	120942482	missense	possibly damaging	0.86
R4656:Ubr1	UTSW	2	120926013	missense	probably benign	0.35
R4928:Ubr1	UTSW	2	120914938	missense	probably damaging	1.00
R4987:Ubr1	UTSW	2	120963566	missense	probably benign	0.00
R5033:Ubr1	UTSW	2	120911997	critical splice donor site	probably null
R5108:Ubr1	UTSW	2	120963422	missense	probably benign	0.20
R5118:Ubr1	UTSW	2	120882264	missense	probably benign	0.20
R5211:Ubr1	UTSW	2	120893170	missense	possibly damaging	0.92
R5215:Ubr1	UTSW	2	120904044	missense	probably benign	0.00
R5449:Ubr1	UTSW	2	120963500	missense	probably benign
R5452:Ubr1	UTSW	2	120868302	missense	possibly damaging	0.95
R5582:Ubr1	UTSW	2	120915407	missense	probably benign
R5610:Ubr1	UTSW	2	120892112	missense	probably benign	0.04
R5637:Ubr1	UTSW	2	120963517	missense	possibly damaging	0.68
R5808:Ubr1	UTSW	2	120961092	missense	possibly damaging	0.63
R5845:Ubr1	UTSW	2	120904005	missense	probably benign
R5979:Ubr1	UTSW	2	120946382	missense	probably benign	0.07
R6044:Ubr1	UTSW	2	120862721	missense	probably benign	0.38
R6146:Ubr1	UTSW	2	120893209	missense	probably damaging	0.98
R6252:Ubr1	UTSW	2	120906895	missense	probably benign	0.21
R6389:Ubr1	UTSW	2	120881039	missense	probably benign	0.03
R6600:Ubr1	UTSW	2	120915399	missense	probably benign	0.00
R6670:Ubr1	UTSW	2	120924130	critical splice donor site	probably null
R6731:Ubr1	UTSW	2	120955640	missense	probably null	0.99
R6836:Ubr1	UTSW	2	120896675	splice site	probably null
R6994:Ubr1	UTSW	2	120963593	missense	probably benign
R7121:Ubr1	UTSW	2	120875498	missense	probably benign	0.00
R7204:Ubr1	UTSW	2	120904077	missense	possibly damaging	0.49
R7209:Ubr1	UTSW	2	120862765	missense	probably benign	0.04
R7434:Ubr1	UTSW	2	120862680	missense	probably benign
R7457:Ubr1	UTSW	2	120917828	missense	probably benign	0.35
R7464:Ubr1	UTSW	2	120889774	critical splice donor site	probably null
R7519:Ubr1	UTSW	2	120875444	missense	possibly damaging	0.63
R7574:Ubr1	UTSW	2	120873191	missense	possibly damaging	0.93
R8030:Ubr1	UTSW	2	120934374	missense	probably damaging	0.99
R8085:Ubr1	UTSW	2	120934417	nonsense	probably null
R8221:Ubr1	UTSW	2	120961104	missense	probably damaging	0.97
R8241:Ubr1	UTSW	2	120963456	missense	possibly damaging	0.80
R8291:Ubr1	UTSW	2	120911115	missense	probably benign
R8293:Ubr1	UTSW	2	120862721	missense	probably benign	0.38
R8420:Ubr1	UTSW	2	120870995	missense	probably benign
R8489:Ubr1	UTSW	2	120881067	missense	probably benign	0.42
R8708:Ubr1	UTSW	2	120866483	missense	probably benign	0.27
R8856:Ubr1	UTSW	2	120904042	missense	probably damaging	1.00
R8995:Ubr1	UTSW	2	120866553	missense	probably damaging	1.00
R9153:Ubr1	UTSW	2	120925988	missense	probably benign	0.00
R9155:Ubr1	UTSW	2	120924134	missense	possibly damaging	0.84
R9156:Ubr1	UTSW	2	120873122	critical splice donor site	probably null
R9194:Ubr1	UTSW	2	120947844	missense	probably damaging	1.00
R9320:Ubr1	UTSW	2	120896519	missense	probably benign	0.04
R9401:Ubr1	UTSW	2	120935284	missense	probably benign	0.06
R9430:Ubr1	UTSW	2	120904025	missense	possibly damaging	0.59

Predicted Primers

PCR Primer
(F):5'- GACCTGCTTAATAAGGAGCCG -3'
(R):5'- GTGGGATCAGCAAGTTGATTTC -3'

Sequencing Primer
(F):5'- TATACTATAGACAGCGATGAACTAGG -3'
(R):5'- GGGATCAGCAAGTTGATTTCTATAC -3'

Posted On

2015-12-21