Mutagenetix > Incidental Mutation

Incidental Mutation 'R4765:Zfhx4'

366042

Institutional Source

Beutler Lab

Gene Symbol

Zfhx4

Ensembl Gene

ENSMUSG00000025255

Gene Name

zinc finger homeodomain 4

Synonyms

Zfh4, C130041O22Rik, Zfh-4

MMRRC Submission

042406-MU

Accession Numbers

Genbank: NM_030708; MGI: 2137668

Is this an essential gene?

Possibly non essential (E-score: 0.471) question?

Stock #

R4765 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

5218526-5415857 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 5400152 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1790 (L1790P)

Ref Sequence

ENSEMBL: ENSMUSP00000135289 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026284] [ENSMUST00000175866] [ENSMUST00000176383]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000026284
AA Change: L1790P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000026284
Gene: ENSMUSG00000025255
AA Change: L1790P

Domain	Start	End	E-Value	Type
ZnF_C2H2	80	99	1.78e2	SMART
low complexity region	110	122	N/A	INTRINSIC
ZnF_C2H2	277	300	1.55e1	SMART
low complexity region	421	438	N/A	INTRINSIC
low complexity region	470	475	N/A	INTRINSIC
low complexity region	590	610	N/A	INTRINSIC
ZnF_C2H2	611	634	2.45e0	SMART
ZnF_C2H2	642	665	6.78e-3	SMART
ZnF_U1	694	728	1.8e-1	SMART
ZnF_C2H2	697	721	4.87e-4	SMART
low complexity region	754	763	N/A	INTRINSIC
ZnF_C2H2	765	789	6.67e-2	SMART
ZnF_C2H2	876	897	2.44e2	SMART
ZnF_U1	912	946	2.88e0	SMART
ZnF_C2H2	915	939	1.23e0	SMART
ZnF_C2H2	971	993	7.05e-1	SMART
ZnF_U1	1016	1050	3.73e0	SMART
ZnF_C2H2	1019	1043	4.98e-1	SMART
ZnF_C2H2	1188	1211	1.1e-2	SMART
ZnF_C2H2	1217	1240	4.94e0	SMART
ZnF_C2H2	1368	1390	7.67e-2	SMART
ZnF_C2H2	1396	1419	1.33e-1	SMART
ZnF_U1	1509	1543	7.4e-1	SMART
ZnF_C2H2	1512	1536	8.22e-2	SMART
ZnF_U1	1561	1595	3.73e0	SMART
ZnF_C2H2	1564	1588	1.16e-1	SMART
low complexity region	1664	1692	N/A	INTRINSIC
low complexity region	1701	1713	N/A	INTRINSIC
low complexity region	1762	1808	N/A	INTRINSIC
ZnF_C2H2	1916	1939	3.07e-1	SMART
low complexity region	1964	1990	N/A	INTRINSIC
low complexity region	2008	2032	N/A	INTRINSIC
low complexity region	2055	2072	N/A	INTRINSIC
HOX	2100	2162	4.23e-16	SMART
HOX	2197	2259	5.62e-21	SMART
ZnF_C2H2	2283	2303	1.13e1	SMART
low complexity region	2364	2376	N/A	INTRINSIC
low complexity region	2408	2425	N/A	INTRINSIC
low complexity region	2449	2460	N/A	INTRINSIC
ZnF_C2H2	2461	2483	2.17e-1	SMART
HOX	2573	2635	3.18e-20	SMART
ZnF_C2H2	2643	2666	6.67e-2	SMART
low complexity region	2874	2886	N/A	INTRINSIC
HOX	2896	2958	4.54e-16	SMART
ZnF_U1	2971	3005	6.59e-1	SMART
ZnF_C2H2	2974	2998	1.36e1	SMART
low complexity region	3066	3078	N/A	INTRINSIC
low complexity region	3106	3119	N/A	INTRINSIC
low complexity region	3163	3186	N/A	INTRINSIC
coiled coil region	3279	3308	N/A	INTRINSIC
ZnF_C2H2	3368	3388	1.12e2	SMART
ZnF_U1	3409	3443	6.16e-2	SMART
ZnF_C2H2	3412	3436	6.57e0	SMART
low complexity region	3461	3479	N/A	INTRINSIC
low complexity region	3505	3527	N/A	INTRINSIC
low complexity region	3536	3547	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000175866
AA Change: L1815P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000135827
Gene: ENSMUSG00000025255
AA Change: L1815P

Domain	Start	End	E-Value	Type
ZnF_C2H2	80	99	1.78e2	SMART
low complexity region	110	122	N/A	INTRINSIC
ZnF_C2H2	277	300	1.55e1	SMART
low complexity region	421	438	N/A	INTRINSIC
low complexity region	470	475	N/A	INTRINSIC
low complexity region	590	610	N/A	INTRINSIC
ZnF_C2H2	611	634	2.45e0	SMART
ZnF_C2H2	642	665	6.78e-3	SMART
ZnF_U1	694	728	1.8e-1	SMART
ZnF_C2H2	697	721	4.87e-4	SMART
low complexity region	754	763	N/A	INTRINSIC
ZnF_C2H2	765	789	6.67e-2	SMART
ZnF_C2H2	902	923	2.44e2	SMART
ZnF_U1	938	972	2.88e0	SMART
ZnF_C2H2	941	965	1.23e0	SMART
ZnF_C2H2	997	1019	7.05e-1	SMART
ZnF_U1	1042	1076	3.73e0	SMART
ZnF_C2H2	1045	1069	4.98e-1	SMART
ZnF_C2H2	1213	1236	1.1e-2	SMART
ZnF_C2H2	1242	1265	4.94e0	SMART
ZnF_C2H2	1393	1415	7.67e-2	SMART
ZnF_C2H2	1421	1444	1.33e-1	SMART
ZnF_U1	1534	1568	7.4e-1	SMART
ZnF_C2H2	1537	1561	8.22e-2	SMART
ZnF_U1	1586	1620	3.73e0	SMART
ZnF_C2H2	1589	1613	1.16e-1	SMART
low complexity region	1689	1717	N/A	INTRINSIC
low complexity region	1726	1738	N/A	INTRINSIC
low complexity region	1787	1833	N/A	INTRINSIC
ZnF_C2H2	1941	1964	3.07e-1	SMART
low complexity region	1989	2015	N/A	INTRINSIC
low complexity region	2033	2057	N/A	INTRINSIC
low complexity region	2080	2097	N/A	INTRINSIC
HOX	2125	2187	4.23e-16	SMART
HOX	2222	2284	5.62e-21	SMART
ZnF_C2H2	2308	2328	1.13e1	SMART
low complexity region	2389	2401	N/A	INTRINSIC
low complexity region	2433	2450	N/A	INTRINSIC
low complexity region	2474	2485	N/A	INTRINSIC
ZnF_C2H2	2486	2508	2.17e-1	SMART
HOX	2598	2660	3.18e-20	SMART
ZnF_C2H2	2668	2691	6.67e-2	SMART
low complexity region	2899	2911	N/A	INTRINSIC
HOX	2921	2983	4.54e-16	SMART
ZnF_U1	2996	3030	6.59e-1	SMART
ZnF_C2H2	2999	3023	1.36e1	SMART
low complexity region	3091	3103	N/A	INTRINSIC
low complexity region	3131	3144	N/A	INTRINSIC
low complexity region	3188	3211	N/A	INTRINSIC
coiled coil region	3304	3333	N/A	INTRINSIC
ZnF_C2H2	3393	3413	1.12e2	SMART
ZnF_U1	3434	3468	6.16e-2	SMART
ZnF_C2H2	3437	3461	6.57e0	SMART
low complexity region	3486	3504	N/A	INTRINSIC
low complexity region	3530	3552	N/A	INTRINSIC
low complexity region	3561	3572	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000176383
AA Change: L1790P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000135289
Gene: ENSMUSG00000025255
AA Change: L1790P

Domain	Start	End	E-Value	Type
ZnF_C2H2	80	99	1.78e2	SMART
low complexity region	110	122	N/A	INTRINSIC
ZnF_C2H2	277	300	1.55e1	SMART
low complexity region	421	438	N/A	INTRINSIC
low complexity region	470	475	N/A	INTRINSIC
low complexity region	590	610	N/A	INTRINSIC
ZnF_C2H2	611	634	2.45e0	SMART
ZnF_C2H2	642	665	6.78e-3	SMART
ZnF_U1	694	728	1.8e-1	SMART
ZnF_C2H2	697	721	4.87e-4	SMART
low complexity region	754	763	N/A	INTRINSIC
ZnF_C2H2	765	789	6.67e-2	SMART
ZnF_C2H2	876	897	2.44e2	SMART
ZnF_U1	912	946	2.88e0	SMART
ZnF_C2H2	915	939	1.23e0	SMART
ZnF_C2H2	971	993	7.05e-1	SMART
ZnF_U1	1016	1050	3.73e0	SMART
ZnF_C2H2	1019	1043	4.98e-1	SMART
ZnF_C2H2	1188	1211	1.1e-2	SMART
ZnF_C2H2	1217	1240	4.94e0	SMART
ZnF_C2H2	1368	1390	7.67e-2	SMART
ZnF_C2H2	1396	1419	1.33e-1	SMART
ZnF_U1	1509	1543	7.4e-1	SMART
ZnF_C2H2	1512	1536	8.22e-2	SMART
ZnF_U1	1561	1595	3.73e0	SMART
ZnF_C2H2	1564	1588	1.16e-1	SMART
low complexity region	1664	1692	N/A	INTRINSIC
low complexity region	1701	1713	N/A	INTRINSIC
low complexity region	1762	1808	N/A	INTRINSIC
ZnF_C2H2	1916	1939	3.07e-1	SMART
low complexity region	1964	1990	N/A	INTRINSIC
low complexity region	2008	2032	N/A	INTRINSIC
low complexity region	2055	2072	N/A	INTRINSIC
HOX	2100	2162	4.23e-16	SMART
HOX	2197	2259	5.62e-21	SMART
ZnF_C2H2	2283	2303	1.13e1	SMART
low complexity region	2364	2376	N/A	INTRINSIC
low complexity region	2408	2425	N/A	INTRINSIC
low complexity region	2449	2460	N/A	INTRINSIC
ZnF_C2H2	2461	2483	2.17e-1	SMART
HOX	2573	2635	3.18e-20	SMART
ZnF_C2H2	2643	2666	6.67e-2	SMART
low complexity region	2874	2886	N/A	INTRINSIC
HOX	2896	2958	4.54e-16	SMART
ZnF_U1	2971	3005	6.59e-1	SMART
ZnF_C2H2	2974	2998	1.36e1	SMART
low complexity region	3066	3078	N/A	INTRINSIC
low complexity region	3106	3119	N/A	INTRINSIC
low complexity region	3163	3186	N/A	INTRINSIC
coiled coil region	3279	3308	N/A	INTRINSIC
ZnF_C2H2	3368	3388	1.12e2	SMART
ZnF_U1	3409	3443	6.16e-2	SMART
ZnF_C2H2	3412	3436	6.57e0	SMART
low complexity region	3461	3479	N/A	INTRINSIC
low complexity region	3505	3527	N/A	INTRINSIC
low complexity region	3536	3547	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	C	T	11: 58,881,161	R490C	probably benign	Het
Abcb11	A	T	2: 69,245,867	F1166I	probably damaging	Het
Acta2	T	C	19: 34,246,152	D181G	probably damaging	Het
Adgrv1	A	G	13: 81,106,919	I6195T	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ankfy1	T	G	11: 72,712,291	S49A	probably benign	Het
Azi2	A	T	9: 118,061,471		probably benign	Het
Bend3	A	T	10: 43,510,750	S380C	probably damaging	Het
Bicc1	T	C	10: 70,940,593	T759A	probably damaging	Het
Cdh10	G	T	15: 19,013,278	V655L	probably damaging	Het
Cdkn2aip	C	A	8: 47,713,547	W75L	probably damaging	Het
Cenpj	G	A	14: 56,549,545	R192*	probably null	Het
Cflar	T	C	1: 58,732,321	S203P	probably damaging	Het
Chd6	A	T	2: 160,966,244	C1683*	probably null	Het
Cpsf2	A	G	12: 101,997,440	Y476C	probably damaging	Het
Cyp4a12a	A	G	4: 115,326,191	D169G	possibly damaging	Het
D430041D05Rik	T	A	2: 104,214,096	R1536S	probably damaging	Het
Depdc5	A	C	5: 32,937,635	D752A	probably damaging	Het
Dnah9	C	T	11: 65,927,726	G78D	probably damaging	Het
Drc1	G	T	5: 30,348,731	Q249H	probably benign	Het
Drg1	T	C	11: 3,250,280	I364V	probably benign	Het
Dtymk	T	C	1: 93,792,909	H130R	probably damaging	Het
Elac2	T	G	11: 64,992,222	F140V	probably damaging	Het
Enpp2	A	G	15: 54,875,672	V353A	possibly damaging	Het
Fat2	T	C	11: 55,281,187	D2900G	probably damaging	Het
Fermt2	G	T	14: 45,462,236	T536K	probably benign	Het
Foxj2	G	T	6: 122,833,271	Q196H	probably benign	Het
Gadl1	A	G	9: 115,966,313	K328R	probably null	Het
Gata6	A	G	18: 11,054,394	T108A	probably benign	Het
Gm16503	G	T	4: 147,541,097	G16V	unknown	Het
Gpr37	T	G	6: 25,669,108	E579A	probably damaging	Het
Gps2	T	C	11: 69,916,361		probably benign	Het
Hcn4	A	T	9: 58,857,977	I581F	unknown	Het
Hfm1	T	A	5: 106,842,539	Y1335F	probably benign	Het
Igsf10	A	T	3: 59,329,705	S1018R	probably benign	Het
Katnal2	C	T	18: 76,977,543		probably null	Het
Kctd8	T	C	5: 69,340,848	K152E	possibly damaging	Het
Lrp8	T	C	4: 107,854,395	C459R	probably damaging	Het
Ly6l	A	T	15: 75,449,694	I48L	probably benign	Het
Megf10	A	T	18: 57,287,794	I835F	possibly damaging	Het
Mei1	A	T	15: 82,112,485	I946F	possibly damaging	Het
Mkl2	C	A	16: 13,412,594	P1048T	probably damaging	Het
Myo7b	G	C	18: 31,961,900	L1881V	probably benign	Het
Nfkbiz	T	C	16: 55,819,024		probably null	Het
Olfr142	T	A	2: 90,252,463	Y175F	probably damaging	Het
Olfr1449	T	C	19: 12,935,076	C113R	possibly damaging	Het
Pcdhgc5	T	C	18: 37,822,069	S799P	probably benign	Het
Plk4	A	G	3: 40,802,022	E97G	probably damaging	Het
Pole2	A	T	12: 69,222,052	H114Q	possibly damaging	Het
Rad9a	C	A	19: 4,200,489	V109L	probably benign	Het
Scn8a	A	G	15: 101,040,471	H1917R	probably benign	Het
Scyl2	C	T	10: 89,659,298	V304I	probably damaging	Het
Serpina3f	G	C	12: 104,219,431	E298D	probably benign	Het
Shoc2	A	G	19: 53,988,303	E208G	probably benign	Het
Sin3a	G	A	9: 57,096,803	V280I	probably benign	Het
Slc26a2	A	T	18: 61,199,486	I291N	probably damaging	Het
Slc4a7	T	G	14: 14,762,414	D600E	probably damaging	Het
Slc5a6	A	T	5: 31,038,083	F430L	possibly damaging	Het
Snx19	A	C	9: 30,440,157	Q840H	probably damaging	Het
Spast	C	A	17: 74,369,216	D340E	probably damaging	Het
Sprr4	G	A	3: 92,500,409	P29S	unknown	Het
Stk11ip	T	G	1: 75,527,155	L239R	probably damaging	Het
Thoc6	A	G	17: 23,670,888	L20P	probably damaging	Het
Tnfrsf8	A	T	4: 145,296,877	S129T	probably benign	Het
Tnrc6c	A	G	11: 117,742,927	I1284V	probably benign	Het
Ttn	A	G	2: 76,710,987	L33885P	probably damaging	Het
Ttn	T	C	2: 76,772,507	Y16711C	probably damaging	Het
Ubn2	T	A	6: 38,479,140	C501S	probably damaging	Het
Ubr1	A	T	2: 120,963,442	L87*	probably null	Het
Uhmk1	T	C	1: 170,199,901	Y320C	probably damaging	Het
Vldlr	T	C	19: 27,240,547	V465A	probably damaging	Het
Vmn1r1	C	T	1: 182,157,906	A65T	probably benign	Het
Vmn2r25	C	T	6: 123,823,223	C720Y	probably damaging	Het
Xrra1	T	C	7: 99,906,568	Y381H	probably benign	Het
Zscan4d	T	A	7: 11,162,667	M259L	probably benign	Het

Other mutations in Zfhx4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Zfhx4	APN	3	5242341	missense	probably damaging	1.00
IGL00915:Zfhx4	APN	3	5245523	missense	probably damaging	0.99
IGL01145:Zfhx4	APN	3	5245347	missense	probably damaging	1.00
IGL01302:Zfhx4	APN	3	5243568	missense	probably damaging	1.00
IGL01314:Zfhx4	APN	3	5413094	missense	probably damaging	0.98
IGL01321:Zfhx4	APN	3	5242328	missense	probably benign	0.01
IGL01328:Zfhx4	APN	3	5244284	missense	probably damaging	1.00
IGL01333:Zfhx4	APN	3	5399327	missense	probably damaging	1.00
IGL01351:Zfhx4	APN	3	5401136	missense	probably damaging	1.00
IGL01524:Zfhx4	APN	3	5243976	missense	probably damaging	1.00
IGL01549:Zfhx4	APN	3	5399462	missense	probably damaging	1.00
IGL01715:Zfhx4	APN	3	5242045	missense	probably benign	0.00
IGL01736:Zfhx4	APN	3	5244092	missense	possibly damaging	0.85
IGL01904:Zfhx4	APN	3	5412709	missense	probably damaging	1.00
IGL02298:Zfhx4	APN	3	5244304	splice site	probably null
IGL02342:Zfhx4	APN	3	5402374	missense	probably benign	0.14
IGL02465:Zfhx4	APN	3	5399603	missense	possibly damaging	0.48
IGL02481:Zfhx4	APN	3	5411843	missense	probably damaging	0.99
IGL02511:Zfhx4	APN	3	5399183	missense	probably damaging	1.00
IGL02571:Zfhx4	APN	3	5329523	missense	probably damaging	1.00
IGL02685:Zfhx4	APN	3	5412153	missense	probably damaging	1.00
IGL02721:Zfhx4	APN	3	5243307	missense	possibly damaging	0.76
IGL02806:Zfhx4	APN	3	5390408	missense	probably benign	0.00
IGL03140:Zfhx4	APN	3	5242525	missense	probably damaging	1.00
IGL03185:Zfhx4	APN	3	5403914	missense	probably benign	0.05
IGL03209:Zfhx4	APN	3	5401171	missense	probably damaging	1.00
IGL03292:Zfhx4	APN	3	5411780	nonsense	probably null
IGL03302:Zfhx4	APN	3	5403713	missense	possibly damaging	0.88
IGL03303:Zfhx4	APN	3	5403350	missense	probably damaging	1.00
IGL03341:Zfhx4	APN	3	5411850	missense	probably damaging	0.98
3-1:Zfhx4	UTSW	3	5403385	missense	probably benign	0.14
B5639:Zfhx4	UTSW	3	5403175	missense	probably damaging	0.99
IGL02796:Zfhx4	UTSW	3	5399539	missense	probably damaging	1.00
IGL03047:Zfhx4	UTSW	3	5243733	missense	probably damaging	0.99
P0025:Zfhx4	UTSW	3	5399588	missense	probably benign	0.04
PIT4377001:Zfhx4	UTSW	3	5242742	missense	probably damaging	0.98
R0090:Zfhx4	UTSW	3	5243625	missense	probably damaging	1.00
R0107:Zfhx4	UTSW	3	5398982	missense	probably damaging	1.00
R0401:Zfhx4	UTSW	3	5401161	missense	possibly damaging	0.87
R0465:Zfhx4	UTSW	3	5245656	splice site	probably benign
R0506:Zfhx4	UTSW	3	5402735	missense	probably damaging	1.00
R0507:Zfhx4	UTSW	3	5400988	nonsense	probably null
R0550:Zfhx4	UTSW	3	5400494	missense	probably damaging	0.99
R0576:Zfhx4	UTSW	3	5402101	missense	probably damaging	1.00
R0590:Zfhx4	UTSW	3	5402633	missense	probably damaging	1.00
R0697:Zfhx4	UTSW	3	5401733	missense	probably damaging	0.99
R0727:Zfhx4	UTSW	3	5401073	missense	probably damaging	0.98
R0762:Zfhx4	UTSW	3	5403820	missense	probably damaging	1.00
R0815:Zfhx4	UTSW	3	5245315	missense	possibly damaging	0.87
R0863:Zfhx4	UTSW	3	5245315	missense	possibly damaging	0.87
R0866:Zfhx4	UTSW	3	5412212	missense	possibly damaging	0.58
R1109:Zfhx4	UTSW	3	5399870	missense	possibly damaging	0.59
R1177:Zfhx4	UTSW	3	5400831	small deletion	probably benign
R1338:Zfhx4	UTSW	3	5396961	missense	possibly damaging	0.86
R1388:Zfhx4	UTSW	3	5401387	missense	probably damaging	1.00
R1434:Zfhx4	UTSW	3	5241859	missense	probably benign	0.00
R1470:Zfhx4	UTSW	3	5413146	makesense	probably null
R1470:Zfhx4	UTSW	3	5413146	makesense	probably null
R1552:Zfhx4	UTSW	3	5403110	missense	probably damaging	1.00
R1589:Zfhx4	UTSW	3	5241729	missense	probably damaging	1.00
R1633:Zfhx4	UTSW	3	5400413	missense	probably damaging	1.00
R1656:Zfhx4	UTSW	3	5413016	missense	probably damaging	1.00
R1717:Zfhx4	UTSW	3	5403104	missense	probably benign	0.20
R1739:Zfhx4	UTSW	3	5401730	missense	probably damaging	1.00
R1760:Zfhx4	UTSW	3	5382616	missense	probably benign
R1842:Zfhx4	UTSW	3	5401498	missense	probably damaging	1.00
R1867:Zfhx4	UTSW	3	5412714	missense	probably damaging	1.00
R1868:Zfhx4	UTSW	3	5412714	missense	probably damaging	1.00
R2064:Zfhx4	UTSW	3	5398927	missense	probably damaging	1.00
R2083:Zfhx4	UTSW	3	5403163	missense	possibly damaging	0.58
R2154:Zfhx4	UTSW	3	5401741	missense	possibly damaging	0.86
R2165:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2181:Zfhx4	UTSW	3	5403332	missense	probably damaging	1.00
R2201:Zfhx4	UTSW	3	5242289	missense	probably damaging	1.00
R2209:Zfhx4	UTSW	3	5396918	missense	probably damaging	1.00
R2303:Zfhx4	UTSW	3	5397060	missense	probably damaging	0.99
R2327:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2420:Zfhx4	UTSW	3	5390405	missense	probably benign	0.00
R2422:Zfhx4	UTSW	3	5390405	missense	probably benign	0.00
R2516:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2518:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2519:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2520:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R2566:Zfhx4	UTSW	3	5245143	missense	probably damaging	0.98
R2922:Zfhx4	UTSW	3	5403664	missense	probably damaging	1.00
R3000:Zfhx4	UTSW	3	5403654	missense	probably damaging	1.00
R3103:Zfhx4	UTSW	3	5399326	missense	probably damaging	1.00
R3409:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R3414:Zfhx4	UTSW	3	5403823	missense	probably damaging	1.00
R3746:Zfhx4	UTSW	3	5243165	missense	possibly damaging	0.82
R3747:Zfhx4	UTSW	3	5243165	missense	possibly damaging	0.82
R3748:Zfhx4	UTSW	3	5243165	missense	possibly damaging	0.82
R3749:Zfhx4	UTSW	3	5243165	missense	possibly damaging	0.82
R3750:Zfhx4	UTSW	3	5243165	missense	possibly damaging	0.82
R3763:Zfhx4	UTSW	3	5403344	missense	probably damaging	1.00
R3826:Zfhx4	UTSW	3	5401209	missense	probably damaging	1.00
R3827:Zfhx4	UTSW	3	5401209	missense	probably damaging	1.00
R3830:Zfhx4	UTSW	3	5401209	missense	probably damaging	1.00
R3877:Zfhx4	UTSW	3	5400785	missense	probably benign
R3919:Zfhx4	UTSW	3	5399115	missense	possibly damaging	0.48
R3922:Zfhx4	UTSW	3	5400647	missense	probably damaging	1.00
R3927:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R3965:Zfhx4	UTSW	3	5403847	missense	probably damaging	1.00
R4004:Zfhx4	UTSW	3	5403358	missense	probably benign	0.32
R4049:Zfhx4	UTSW	3	5398859	missense	probably damaging	1.00
R4073:Zfhx4	UTSW	3	5399324	missense	probably damaging	1.00
R4134:Zfhx4	UTSW	3	5243627	missense	probably damaging	1.00
R4401:Zfhx4	UTSW	3	5403345	nonsense	probably null
R4439:Zfhx4	UTSW	3	5214815	unclassified	probably benign
R4497:Zfhx4	UTSW	3	5399620	missense	possibly damaging	0.88
R4518:Zfhx4	UTSW	3	5412518	missense	probably damaging	1.00
R4569:Zfhx4	UTSW	3	5401834	missense	probably benign	0.00
R4612:Zfhx4	UTSW	3	5397063	missense	probably damaging	1.00
R4616:Zfhx4	UTSW	3	5413067	missense	possibly damaging	0.66
R4626:Zfhx4	UTSW	3	5402639	missense	probably damaging	1.00
R4628:Zfhx4	UTSW	3	5403476	missense	probably damaging	1.00
R4637:Zfhx4	UTSW	3	5403404	missense	probably damaging	1.00
R4647:Zfhx4	UTSW	3	5399281	missense	probably damaging	0.99
R4708:Zfhx4	UTSW	3	5245503	splice site	probably null
R4729:Zfhx4	UTSW	3	5399497	missense	probably damaging	1.00
R4732:Zfhx4	UTSW	3	5214807	unclassified	probably benign
R4757:Zfhx4	UTSW	3	5400062	missense	possibly damaging	0.85
R4819:Zfhx4	UTSW	3	5403914	missense	probably benign	0.05
R4937:Zfhx4	UTSW	3	5242011	missense	probably damaging	1.00
R4980:Zfhx4	UTSW	3	5398979	missense	possibly damaging	0.47
R5124:Zfhx4	UTSW	3	5242047	missense	probably damaging	1.00
R5214:Zfhx4	UTSW	3	5403641	missense	probably damaging	1.00
R5361:Zfhx4	UTSW	3	5399207	missense	probably damaging	0.99
R5375:Zfhx4	UTSW	3	5412425	missense	probably damaging	0.99
R5485:Zfhx4	UTSW	3	5243007	missense	probably damaging	1.00
R5588:Zfhx4	UTSW	3	5403138	missense	probably damaging	1.00
R5609:Zfhx4	UTSW	3	5403619	missense	probably damaging	1.00
R5726:Zfhx4	UTSW	3	5403321	missense	probably benign	0.02
R5758:Zfhx4	UTSW	3	5402620	missense	probably damaging	1.00
R5865:Zfhx4	UTSW	3	5402659	missense	probably damaging	1.00
R5938:Zfhx4	UTSW	3	5402138	missense	probably damaging	0.99
R5952:Zfhx4	UTSW	3	5396970	missense	probably damaging	0.99
R6043:Zfhx4	UTSW	3	5403427	missense	probably benign	0.00
R6045:Zfhx4	UTSW	3	5396959	missense	probably damaging	1.00
R6125:Zfhx4	UTSW	3	5398811	missense	possibly damaging	0.68
R6354:Zfhx4	UTSW	3	5401951	missense	probably benign
R6374:Zfhx4	UTSW	3	5244035	missense	probably damaging	1.00
R6378:Zfhx4	UTSW	3	5243350	missense	probably benign	0.07
R6380:Zfhx4	UTSW	3	5413110	missense	probably damaging	0.99
R6413:Zfhx4	UTSW	3	5243145	missense	probably damaging	1.00
R6449:Zfhx4	UTSW	3	5242428	missense	probably damaging	1.00
R6539:Zfhx4	UTSW	3	5244108	missense	probably damaging	0.99
R6714:Zfhx4	UTSW	3	5241837	missense	probably damaging	1.00
R6933:Zfhx4	UTSW	3	5412987	missense	probably damaging	0.99
R6982:Zfhx4	UTSW	3	5403830	missense	probably damaging	1.00
R7104:Zfhx4	UTSW	3	5402489	missense	probably damaging	0.97
R7127:Zfhx4	UTSW	3	5413044	missense	probably damaging	0.99
R7138:Zfhx4	UTSW	3	5412047	missense	possibly damaging	0.69
R7161:Zfhx4	UTSW	3	5244083	missense	possibly damaging	0.65
R7213:Zfhx4	UTSW	3	5396644	missense	probably benign
R7483:Zfhx4	UTSW	3	5412177	missense	probably damaging	0.98
R7514:Zfhx4	UTSW	3	5242207	missense	possibly damaging	0.91
R7544:Zfhx4	UTSW	3	5412815	missense	probably damaging	0.98
R7565:Zfhx4	UTSW	3	5390366	missense	probably benign	0.04
R7611:Zfhx4	UTSW	3	5403771	missense	probably damaging	1.00
R7640:Zfhx4	UTSW	3	5412480	missense	probably benign	0.19
R7649:Zfhx4	UTSW	3	5242110	missense	probably damaging	1.00
R7689:Zfhx4	UTSW	3	5411886	missense	probably benign	0.05
R7711:Zfhx4	UTSW	3	5396956	missense	probably damaging	0.98
R7895:Zfhx4	UTSW	3	5242199	missense	probably benign	0.00
R7920:Zfhx4	UTSW	3	5400455	missense	possibly damaging	0.62
R7972:Zfhx4	UTSW	3	5412473	missense	probably benign	0.02
R7993:Zfhx4	UTSW	3	5412987	missense	probably damaging	1.00
R8133:Zfhx4	UTSW	3	5400494	missense	probably damaging	0.99
R8158:Zfhx4	UTSW	3	5398950	nonsense	probably null
R8272:Zfhx4	UTSW	3	5243867	missense	probably damaging	0.99
R8285:Zfhx4	UTSW	3	5401856	missense	probably benign	0.17
R8321:Zfhx4	UTSW	3	5401127	missense	probably damaging	1.00
R8381:Zfhx4	UTSW	3	5382616	missense	probably benign	0.00
R8434:Zfhx4	UTSW	3	5398858	missense	probably damaging	0.99
R8466:Zfhx4	UTSW	3	5242702	missense	probably damaging	1.00
R8515:Zfhx4	UTSW	3	5399474	missense	probably benign	0.00
R8525:Zfhx4	UTSW	3	5399543	missense	probably damaging	1.00
R8743:Zfhx4	UTSW	3	5244024	missense	probably damaging	1.00
R8830:Zfhx4	UTSW	3	5398889	missense	probably damaging	1.00
R8839:Zfhx4	UTSW	3	5401855	missense	probably benign
R8856:Zfhx4	UTSW	3	5390424	missense	probably benign	0.45
R8900:Zfhx4	UTSW	3	5398864	missense	probably damaging	1.00
R8917:Zfhx4	UTSW	3	5399099	missense	probably damaging	1.00
R9101:Zfhx4	UTSW	3	5412138	missense	probably benign	0.10
R9126:Zfhx4	UTSW	3	5329529	missense	probably damaging	0.99
R9159:Zfhx4	UTSW	3	5399252	missense	probably damaging	0.98
R9159:Zfhx4	UTSW	3	5401157	missense	probably damaging	1.00
R9241:Zfhx4	UTSW	3	5243637	missense	probably damaging	1.00
R9295:Zfhx4	UTSW	3	5329465	missense	probably benign
R9376:Zfhx4	UTSW	3	5241773	missense	probably damaging	1.00
R9376:Zfhx4	UTSW	3	5400335	missense	probably benign	0.04
R9550:Zfhx4	UTSW	3	5399512	missense	probably damaging	1.00
R9680:Zfhx4	UTSW	3	5400596	missense	probably damaging	1.00
R9782:Zfhx4	UTSW	3	5401454	missense	probably benign	0.38
R9787:Zfhx4	UTSW	3	5390446	missense	possibly damaging	0.94
R9790:Zfhx4	UTSW	3	5399862	missense	probably damaging	1.00
R9791:Zfhx4	UTSW	3	5399862	missense	probably damaging	1.00
RF019:Zfhx4	UTSW	3	5403267	missense	probably benign	0.08
X0025:Zfhx4	UTSW	3	5411836	missense	probably damaging	0.99
X0026:Zfhx4	UTSW	3	5412338	missense	probably benign	0.00
X0028:Zfhx4	UTSW	3	5402414	missense	probably benign	0.13
X0028:Zfhx4	UTSW	3	5403267	missense	probably damaging	1.00
X0054:Zfhx4	UTSW	3	5399710	nonsense	probably null
Z1177:Zfhx4	UTSW	3	5242446	missense	probably damaging	1.00
Z1187:Zfhx4	UTSW	3	5243007	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACATTTGGGGTGCCAGGTATG -3'
(R):5'- GCTATTCGGGGTGGAGGAATAC -3'

Sequencing Primer
(F):5'- CAGGTATGACTGGCATGGC -3'
(R):5'- ACAAGGTTCTAAAGACTTTTGCTTC -3'

Posted On

2015-12-21