Incidental Mutation 'R4765:Lrp8'
ID 366047
Institutional Source Beutler Lab
Gene Symbol Lrp8
Ensembl Gene ENSMUSG00000028613
Gene Name low density lipoprotein receptor-related protein 8, apolipoprotein e receptor
Synonyms 4932703M08Rik, Lr8b, apoER2
MMRRC Submission 042406-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.477) question?
Stock # R4765 (G1)
Quality Score 180
Status Not validated
Chromosome 4
Chromosomal Location 107659337-107734037 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107711592 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 459 (C459R)
Ref Sequence ENSEMBL: ENSMUSP00000030356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030356] [ENSMUST00000106732] [ENSMUST00000106733] [ENSMUST00000126573] [ENSMUST00000143601]
AlphaFold Q924X6
Predicted Effect probably damaging
Transcript: ENSMUST00000030356
AA Change: C459R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030356
Gene: ENSMUSG00000028613
AA Change: C459R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 160 197 3.52e-14 SMART
LDLa 199 239 8.09e-14 SMART
LDLa 250 288 4.05e-14 SMART
LDLa 290 327 4.58e-13 SMART
EGF 331 367 2.83e-5 SMART
EGF_CA 368 407 9.91e-10 SMART
LY 434 476 8.44e-4 SMART
LY 481 523 2.29e-14 SMART
LY 524 567 5.96e-13 SMART
LY 568 610 4.21e-13 SMART
LY 612 654 7.24e-3 SMART
EGF 681 727 1.56e1 SMART
low complexity region 729 745 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
low complexity region 863 869 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000106731
AA Change: C261R
SMART Domains Protein: ENSMUSP00000102342
Gene: ENSMUSG00000028613
AA Change: C261R

DomainStartEndE-ValueType
EGF_like 9 47 3.29e1 SMART
LDLa 9 48 2.45e-13 SMART
LDLa 50 89 1.19e-11 SMART
LDLa 93 130 4.58e-13 SMART
EGF 134 170 2.83e-5 SMART
EGF_CA 171 210 9.91e-10 SMART
LY 237 279 8.44e-4 SMART
LY 284 326 2.29e-14 SMART
LY 327 370 5.96e-13 SMART
LY 371 413 4.21e-13 SMART
LY 415 457 7.24e-3 SMART
EGF 484 530 1.56e1 SMART
low complexity region 532 548 N/A INTRINSIC
low complexity region 586 601 N/A INTRINSIC
transmembrane domain 621 643 N/A INTRINSIC
low complexity region 666 672 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106732
AA Change: C374R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102343
Gene: ENSMUSG00000028613
AA Change: C374R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 164 201 4.58e-13 SMART
LDLa 204 244 1.4e-8 SMART
EGF 246 282 2.83e-5 SMART
EGF_CA 283 322 9.91e-10 SMART
LY 349 391 8.44e-4 SMART
LY 396 438 2.29e-14 SMART
LY 439 482 5.96e-13 SMART
LY 483 525 4.21e-13 SMART
LY 527 569 7.24e-3 SMART
EGF 596 642 1.56e1 SMART
low complexity region 644 660 N/A INTRINSIC
low complexity region 698 713 N/A INTRINSIC
transmembrane domain 733 755 N/A INTRINSIC
low complexity region 778 784 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106733
AA Change: C459R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102344
Gene: ENSMUSG00000028613
AA Change: C459R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 160 197 3.52e-14 SMART
LDLa 199 239 8.09e-14 SMART
LDLa 250 288 4.05e-14 SMART
LDLa 290 327 4.58e-13 SMART
EGF 331 367 2.83e-5 SMART
EGF_CA 368 407 9.91e-10 SMART
LY 434 476 8.44e-4 SMART
LY 481 523 2.29e-14 SMART
LY 524 567 5.96e-13 SMART
LY 568 610 4.21e-13 SMART
LY 612 654 7.24e-3 SMART
EGF 681 727 1.56e1 SMART
low complexity region 729 745 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
low complexity region 863 869 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123140
Predicted Effect probably damaging
Transcript: ENSMUST00000126573
AA Change: C332R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118020
Gene: ENSMUSG00000028613
AA Change: C332R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 163 200 4.58e-13 SMART
EGF 204 240 2.83e-5 SMART
EGF_CA 241 280 9.91e-10 SMART
LY 307 349 8.44e-4 SMART
LY 354 396 2.29e-14 SMART
LY 397 440 5.96e-13 SMART
LY 441 483 4.21e-13 SMART
LY 485 527 7.24e-3 SMART
EGF 554 600 1.56e1 SMART
transmembrane domain 616 638 N/A INTRINSIC
low complexity region 661 667 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135022
Predicted Effect probably damaging
Transcript: ENSMUST00000143601
AA Change: C500R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115854
Gene: ENSMUSG00000028613
AA Change: C500R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 160 197 3.52e-14 SMART
LDLa 199 239 8.09e-14 SMART
LDLa 250 288 4.05e-14 SMART
LDLa 290 327 4.58e-13 SMART
LDLa 330 370 1.4e-8 SMART
EGF 372 408 2.83e-5 SMART
EGF_CA 409 448 9.91e-10 SMART
LY 475 517 8.44e-4 SMART
LY 522 564 2.29e-14 SMART
LY 565 608 5.96e-13 SMART
LY 609 651 4.21e-13 SMART
LY 653 695 7.24e-3 SMART
EGF 722 768 1.56e1 SMART
low complexity region 770 786 N/A INTRINSIC
low complexity region 824 839 N/A INTRINSIC
transmembrane domain 859 881 N/A INTRINSIC
low complexity region 904 910 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147319
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein receptor (LDLR) family. Low density lipoprotein receptors are cell surface proteins that play roles in both signal transduction and receptor-mediated endocytosis of specific ligands for lysosomal degradation. The encoded protein plays a critical role in the migration of neurons during development by mediating Reelin signaling, and also functions as a receptor for the cholesterol transport protein apolipoprotein E. Expression of this gene may be a marker for major depressive disorder. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired granule cell migration, radial glial scaffold formation, contextual fear conditioning, and long-term potentiation. Mutant males have abnormal sperm and are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,771,987 (GRCm39) R490C probably benign Het
Abcb11 A T 2: 69,076,211 (GRCm39) F1166I probably damaging Het
Acta2 T C 19: 34,223,552 (GRCm39) D181G probably damaging Het
Adgrv1 A G 13: 81,255,038 (GRCm39) I6195T probably damaging Het
Afg3l2 G T 18: 67,554,329 (GRCm39) L458M probably damaging Het
Ankfy1 T G 11: 72,603,117 (GRCm39) S49A probably benign Het
Azi2 A T 9: 117,890,539 (GRCm39) probably benign Het
Bend3 A T 10: 43,386,746 (GRCm39) S380C probably damaging Het
Bicc1 T C 10: 70,776,423 (GRCm39) T759A probably damaging Het
Cdh10 G T 15: 19,013,364 (GRCm39) V655L probably damaging Het
Cdkn2aip C A 8: 48,166,582 (GRCm39) W75L probably damaging Het
Cenpj G A 14: 56,787,002 (GRCm39) R192* probably null Het
Cflar T C 1: 58,771,480 (GRCm39) S203P probably damaging Het
Chd6 A T 2: 160,808,164 (GRCm39) C1683* probably null Het
Cpsf2 A G 12: 101,963,699 (GRCm39) Y476C probably damaging Het
Cyp4a12a A G 4: 115,183,388 (GRCm39) D169G possibly damaging Het
D430041D05Rik T A 2: 104,044,441 (GRCm39) R1536S probably damaging Het
Depdc5 A C 5: 33,094,979 (GRCm39) D752A probably damaging Het
Dnah9 C T 11: 65,818,552 (GRCm39) G78D probably damaging Het
Drc1 G T 5: 30,506,075 (GRCm39) Q249H probably benign Het
Drg1 T C 11: 3,200,280 (GRCm39) I364V probably benign Het
Dtymk T C 1: 93,720,631 (GRCm39) H130R probably damaging Het
Elac2 T G 11: 64,883,048 (GRCm39) F140V probably damaging Het
Enpp2 A G 15: 54,739,068 (GRCm39) V353A possibly damaging Het
Fat2 T C 11: 55,172,013 (GRCm39) D2900G probably damaging Het
Fermt2 G T 14: 45,699,693 (GRCm39) T536K probably benign Het
Foxj2 G T 6: 122,810,230 (GRCm39) Q196H probably benign Het
Gadl1 A G 9: 115,795,381 (GRCm39) K328R probably null Het
Gata6 A G 18: 11,054,394 (GRCm39) T108A probably benign Het
Gm16503 G T 4: 147,625,554 (GRCm39) G16V unknown Het
Gpr37 T G 6: 25,669,107 (GRCm39) E579A probably damaging Het
Gps2 T C 11: 69,807,187 (GRCm39) probably benign Het
Hcn4 A T 9: 58,765,260 (GRCm39) I581F unknown Het
Hfm1 T A 5: 106,990,405 (GRCm39) Y1335F probably benign Het
Igsf10 A T 3: 59,237,126 (GRCm39) S1018R probably benign Het
Katnal2 C T 18: 77,065,239 (GRCm39) probably null Het
Kctd8 T C 5: 69,498,191 (GRCm39) K152E possibly damaging Het
Ly6l A T 15: 75,321,543 (GRCm39) I48L probably benign Het
Megf10 A T 18: 57,420,866 (GRCm39) I835F possibly damaging Het
Mei1 A T 15: 81,996,686 (GRCm39) I946F possibly damaging Het
Mrtfb C A 16: 13,230,458 (GRCm39) P1048T probably damaging Het
Myo7b G C 18: 32,094,953 (GRCm39) L1881V probably benign Het
Nfkbiz T C 16: 55,639,387 (GRCm39) probably null Het
Or4b13 T A 2: 90,082,807 (GRCm39) Y175F probably damaging Het
Or5b24 T C 19: 12,912,440 (GRCm39) C113R possibly damaging Het
Pcdhgc5 T C 18: 37,955,122 (GRCm39) S799P probably benign Het
Plk4 A G 3: 40,756,457 (GRCm39) E97G probably damaging Het
Pole2 A T 12: 69,268,826 (GRCm39) H114Q possibly damaging Het
Rad9a C A 19: 4,250,488 (GRCm39) V109L probably benign Het
Scn8a A G 15: 100,938,352 (GRCm39) H1917R probably benign Het
Scyl2 C T 10: 89,495,160 (GRCm39) V304I probably damaging Het
Serpina3f G C 12: 104,185,690 (GRCm39) E298D probably benign Het
Shoc2 A G 19: 53,976,734 (GRCm39) E208G probably benign Het
Sin3a G A 9: 57,004,087 (GRCm39) V280I probably benign Het
Slc26a2 A T 18: 61,332,558 (GRCm39) I291N probably damaging Het
Slc4a7 T G 14: 14,762,414 (GRCm38) D600E probably damaging Het
Slc5a6 A T 5: 31,195,427 (GRCm39) F430L possibly damaging Het
Snx19 A C 9: 30,351,453 (GRCm39) Q840H probably damaging Het
Spast C A 17: 74,676,211 (GRCm39) D340E probably damaging Het
Sprr4 G A 3: 92,407,716 (GRCm39) P29S unknown Het
Stk11ip T G 1: 75,503,799 (GRCm39) L239R probably damaging Het
Thoc6 A G 17: 23,889,862 (GRCm39) L20P probably damaging Het
Tnfrsf8 A T 4: 145,023,447 (GRCm39) S129T probably benign Het
Tnrc6c A G 11: 117,633,753 (GRCm39) I1284V probably benign Het
Ttn T C 2: 76,602,851 (GRCm39) Y16711C probably damaging Het
Ttn A G 2: 76,541,331 (GRCm39) L33885P probably damaging Het
Ubn2 T A 6: 38,456,075 (GRCm39) C501S probably damaging Het
Ubr1 A T 2: 120,793,923 (GRCm39) L87* probably null Het
Uhmk1 T C 1: 170,027,470 (GRCm39) Y320C probably damaging Het
Vldlr T C 19: 27,217,947 (GRCm39) V465A probably damaging Het
Vmn1r1 C T 1: 181,985,471 (GRCm39) A65T probably benign Het
Vmn2r25 C T 6: 123,800,182 (GRCm39) C720Y probably damaging Het
Xrra1 T C 7: 99,555,775 (GRCm39) Y381H probably benign Het
Zfhx4 T C 3: 5,465,212 (GRCm39) L1790P probably benign Het
Zscan4d T A 7: 10,896,594 (GRCm39) M259L probably benign Het
Other mutations in Lrp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Lrp8 APN 4 107,721,273 (GRCm39) missense probably benign 0.04
IGL01514:Lrp8 APN 4 107,712,881 (GRCm39) missense probably damaging 1.00
IGL02058:Lrp8 APN 4 107,727,306 (GRCm39) missense probably benign 0.25
IGL02398:Lrp8 APN 4 107,726,245 (GRCm39) missense probably damaging 1.00
IGL02398:Lrp8 APN 4 107,704,691 (GRCm39) missense probably damaging 0.97
IGL02706:Lrp8 APN 4 107,660,516 (GRCm39) nonsense probably null
IGL02754:Lrp8 APN 4 107,691,952 (GRCm39) splice site probably null
IGL02967:Lrp8 APN 4 107,718,431 (GRCm39) missense probably benign 0.21
IGL03080:Lrp8 APN 4 107,712,996 (GRCm39) missense probably damaging 1.00
IGL02837:Lrp8 UTSW 4 107,718,478 (GRCm39) missense probably benign 0.01
R0312:Lrp8 UTSW 4 107,664,052 (GRCm39) intron probably benign
R0440:Lrp8 UTSW 4 107,726,295 (GRCm39) missense probably damaging 0.99
R0598:Lrp8 UTSW 4 107,714,434 (GRCm39) missense possibly damaging 0.73
R1627:Lrp8 UTSW 4 107,711,613 (GRCm39) missense probably damaging 0.99
R1967:Lrp8 UTSW 4 107,717,168 (GRCm39) missense probably damaging 1.00
R2183:Lrp8 UTSW 4 107,660,462 (GRCm39) missense probably damaging 1.00
R2208:Lrp8 UTSW 4 107,712,987 (GRCm39) missense probably damaging 1.00
R2325:Lrp8 UTSW 4 107,721,206 (GRCm39) missense probably benign 0.03
R3712:Lrp8 UTSW 4 107,705,499 (GRCm39) missense probably benign 0.08
R4093:Lrp8 UTSW 4 107,700,468 (GRCm39) nonsense probably null
R4706:Lrp8 UTSW 4 107,718,470 (GRCm39) missense probably benign 0.00
R4840:Lrp8 UTSW 4 107,727,234 (GRCm39) missense possibly damaging 0.79
R4900:Lrp8 UTSW 4 107,664,006 (GRCm39) intron probably benign
R5033:Lrp8 UTSW 4 107,691,952 (GRCm39) splice site probably null
R5280:Lrp8 UTSW 4 107,711,518 (GRCm39) missense probably damaging 1.00
R5381:Lrp8 UTSW 4 107,726,307 (GRCm39) missense probably damaging 1.00
R5935:Lrp8 UTSW 4 107,714,493 (GRCm39) missense probably damaging 1.00
R5972:Lrp8 UTSW 4 107,726,267 (GRCm39) missense probably damaging 1.00
R6076:Lrp8 UTSW 4 107,704,656 (GRCm39) missense possibly damaging 0.81
R6343:Lrp8 UTSW 4 107,726,353 (GRCm39) splice site probably null
R6805:Lrp8 UTSW 4 107,711,517 (GRCm39) missense probably damaging 0.99
R7100:Lrp8 UTSW 4 107,659,647 (GRCm39) missense possibly damaging 0.93
R7262:Lrp8 UTSW 4 107,704,661 (GRCm39) missense probably benign
R7717:Lrp8 UTSW 4 107,691,940 (GRCm39) missense probably benign 0.00
R7949:Lrp8 UTSW 4 107,660,524 (GRCm39) missense probably damaging 1.00
R8350:Lrp8 UTSW 4 107,704,661 (GRCm39) missense probably benign
R8371:Lrp8 UTSW 4 107,726,268 (GRCm39) missense probably damaging 1.00
R9272:Lrp8 UTSW 4 107,717,158 (GRCm39) missense probably benign 0.19
R9461:Lrp8 UTSW 4 107,700,515 (GRCm39) missense possibly damaging 0.93
R9567:Lrp8 UTSW 4 107,711,469 (GRCm39) missense probably damaging 0.99
Z1177:Lrp8 UTSW 4 107,700,529 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGAACTTGTGTCTCTAGGCTCC -3'
(R):5'- TAGGATGTGGACTCAAGGCTG -3'

Sequencing Primer
(F):5'- TGCATTCTCCACTGACACTG -3'
(R):5'- GGACTCAAGGCTGTTTCCCTACAG -3'
Posted On 2015-12-21