Incidental Mutation 'R4765:Lrp8'
ID366047
Institutional Source Beutler Lab
Gene Symbol Lrp8
Ensembl Gene ENSMUSG00000028613
Gene Namelow density lipoprotein receptor-related protein 8, apolipoprotein e receptor
SynonymsLr8b, 4932703M08Rik, apoER2
MMRRC Submission 042406-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.509) question?
Stock #R4765 (G1)
Quality Score180
Status Not validated
Chromosome4
Chromosomal Location107802261-107876840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107854395 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 459 (C459R)
Ref Sequence ENSEMBL: ENSMUSP00000030356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030356] [ENSMUST00000106732] [ENSMUST00000106733] [ENSMUST00000126573] [ENSMUST00000143601]
Predicted Effect probably damaging
Transcript: ENSMUST00000030356
AA Change: C459R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030356
Gene: ENSMUSG00000028613
AA Change: C459R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 160 197 3.52e-14 SMART
LDLa 199 239 8.09e-14 SMART
LDLa 250 288 4.05e-14 SMART
LDLa 290 327 4.58e-13 SMART
EGF 331 367 2.83e-5 SMART
EGF_CA 368 407 9.91e-10 SMART
LY 434 476 8.44e-4 SMART
LY 481 523 2.29e-14 SMART
LY 524 567 5.96e-13 SMART
LY 568 610 4.21e-13 SMART
LY 612 654 7.24e-3 SMART
EGF 681 727 1.56e1 SMART
low complexity region 729 745 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
low complexity region 863 869 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000106731
AA Change: C261R
SMART Domains Protein: ENSMUSP00000102342
Gene: ENSMUSG00000028613
AA Change: C261R

DomainStartEndE-ValueType
EGF_like 9 47 3.29e1 SMART
LDLa 9 48 2.45e-13 SMART
LDLa 50 89 1.19e-11 SMART
LDLa 93 130 4.58e-13 SMART
EGF 134 170 2.83e-5 SMART
EGF_CA 171 210 9.91e-10 SMART
LY 237 279 8.44e-4 SMART
LY 284 326 2.29e-14 SMART
LY 327 370 5.96e-13 SMART
LY 371 413 4.21e-13 SMART
LY 415 457 7.24e-3 SMART
EGF 484 530 1.56e1 SMART
low complexity region 532 548 N/A INTRINSIC
low complexity region 586 601 N/A INTRINSIC
transmembrane domain 621 643 N/A INTRINSIC
low complexity region 666 672 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106732
AA Change: C374R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102343
Gene: ENSMUSG00000028613
AA Change: C374R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 164 201 4.58e-13 SMART
LDLa 204 244 1.4e-8 SMART
EGF 246 282 2.83e-5 SMART
EGF_CA 283 322 9.91e-10 SMART
LY 349 391 8.44e-4 SMART
LY 396 438 2.29e-14 SMART
LY 439 482 5.96e-13 SMART
LY 483 525 4.21e-13 SMART
LY 527 569 7.24e-3 SMART
EGF 596 642 1.56e1 SMART
low complexity region 644 660 N/A INTRINSIC
low complexity region 698 713 N/A INTRINSIC
transmembrane domain 733 755 N/A INTRINSIC
low complexity region 778 784 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106733
AA Change: C459R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102344
Gene: ENSMUSG00000028613
AA Change: C459R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 160 197 3.52e-14 SMART
LDLa 199 239 8.09e-14 SMART
LDLa 250 288 4.05e-14 SMART
LDLa 290 327 4.58e-13 SMART
EGF 331 367 2.83e-5 SMART
EGF_CA 368 407 9.91e-10 SMART
LY 434 476 8.44e-4 SMART
LY 481 523 2.29e-14 SMART
LY 524 567 5.96e-13 SMART
LY 568 610 4.21e-13 SMART
LY 612 654 7.24e-3 SMART
EGF 681 727 1.56e1 SMART
low complexity region 729 745 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
low complexity region 863 869 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123140
Predicted Effect probably damaging
Transcript: ENSMUST00000126573
AA Change: C332R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000118020
Gene: ENSMUSG00000028613
AA Change: C332R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 163 200 4.58e-13 SMART
EGF 204 240 2.83e-5 SMART
EGF_CA 241 280 9.91e-10 SMART
LY 307 349 8.44e-4 SMART
LY 354 396 2.29e-14 SMART
LY 397 440 5.96e-13 SMART
LY 441 483 4.21e-13 SMART
LY 485 527 7.24e-3 SMART
EGF 554 600 1.56e1 SMART
transmembrane domain 616 638 N/A INTRINSIC
low complexity region 661 667 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135022
Predicted Effect probably damaging
Transcript: ENSMUST00000143601
AA Change: C500R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115854
Gene: ENSMUSG00000028613
AA Change: C500R

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 160 197 3.52e-14 SMART
LDLa 199 239 8.09e-14 SMART
LDLa 250 288 4.05e-14 SMART
LDLa 290 327 4.58e-13 SMART
LDLa 330 370 1.4e-8 SMART
EGF 372 408 2.83e-5 SMART
EGF_CA 409 448 9.91e-10 SMART
LY 475 517 8.44e-4 SMART
LY 522 564 2.29e-14 SMART
LY 565 608 5.96e-13 SMART
LY 609 651 4.21e-13 SMART
LY 653 695 7.24e-3 SMART
EGF 722 768 1.56e1 SMART
low complexity region 770 786 N/A INTRINSIC
low complexity region 824 839 N/A INTRINSIC
transmembrane domain 859 881 N/A INTRINSIC
low complexity region 904 910 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147319
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein receptor (LDLR) family. Low density lipoprotein receptors are cell surface proteins that play roles in both signal transduction and receptor-mediated endocytosis of specific ligands for lysosomal degradation. The encoded protein plays a critical role in the migration of neurons during development by mediating Reelin signaling, and also functions as a receptor for the cholesterol transport protein apolipoprotein E. Expression of this gene may be a marker for major depressive disorder. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired granule cell migration, radial glial scaffold formation, contextual fear conditioning, and long-term potentiation. Mutant males have abnormal sperm and are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,881,161 R490C probably benign Het
Abcb11 A T 2: 69,245,867 F1166I probably damaging Het
Acta2 T C 19: 34,246,152 D181G probably damaging Het
Adgrv1 A G 13: 81,106,919 I6195T probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankfy1 T G 11: 72,712,291 S49A probably benign Het
Azi2 A T 9: 118,061,471 probably benign Het
Bend3 A T 10: 43,510,750 S380C probably damaging Het
Bicc1 T C 10: 70,940,593 T759A probably damaging Het
Cdh10 G T 15: 19,013,278 V655L probably damaging Het
Cdkn2aip C A 8: 47,713,547 W75L probably damaging Het
Cenpj G A 14: 56,549,545 R192* probably null Het
Cflar T C 1: 58,732,321 S203P probably damaging Het
Chd6 A T 2: 160,966,244 C1683* probably null Het
Cpsf2 A G 12: 101,997,440 Y476C probably damaging Het
Cyp4a12a A G 4: 115,326,191 D169G possibly damaging Het
D430041D05Rik T A 2: 104,214,096 R1536S probably damaging Het
Depdc5 A C 5: 32,937,635 D752A probably damaging Het
Dnah9 C T 11: 65,927,726 G78D probably damaging Het
Drc1 G T 5: 30,348,731 Q249H probably benign Het
Drg1 T C 11: 3,250,280 I364V probably benign Het
Dtymk T C 1: 93,792,909 H130R probably damaging Het
Elac2 T G 11: 64,992,222 F140V probably damaging Het
Enpp2 A G 15: 54,875,672 V353A possibly damaging Het
Fat2 T C 11: 55,281,187 D2900G probably damaging Het
Fermt2 G T 14: 45,462,236 T536K probably benign Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gadl1 A G 9: 115,966,313 K328R probably null Het
Gata6 A G 18: 11,054,394 T108A probably benign Het
Gm16503 G T 4: 147,541,097 G16V unknown Het
Gpr37 T G 6: 25,669,108 E579A probably damaging Het
Gps2 T C 11: 69,916,361 probably benign Het
Hcn4 A T 9: 58,857,977 I581F unknown Het
Hfm1 T A 5: 106,842,539 Y1335F probably benign Het
Igsf10 A T 3: 59,329,705 S1018R probably benign Het
Katnal2 C T 18: 76,977,543 probably null Het
Kctd8 T C 5: 69,340,848 K152E possibly damaging Het
Ly6l A T 15: 75,449,694 I48L probably benign Het
Megf10 A T 18: 57,287,794 I835F possibly damaging Het
Mei1 A T 15: 82,112,485 I946F possibly damaging Het
Mkl2 C A 16: 13,412,594 P1048T probably damaging Het
Myo7b G C 18: 31,961,900 L1881V probably benign Het
Nfkbiz T C 16: 55,819,024 probably null Het
Olfr142 T A 2: 90,252,463 Y175F probably damaging Het
Olfr1449 T C 19: 12,935,076 C113R possibly damaging Het
Pcdhgc5 T C 18: 37,822,069 S799P probably benign Het
Plk4 A G 3: 40,802,022 E97G probably damaging Het
Pole2 A T 12: 69,222,052 H114Q possibly damaging Het
Rad9a C A 19: 4,200,489 V109L probably benign Het
Scn8a A G 15: 101,040,471 H1917R probably benign Het
Scyl2 C T 10: 89,659,298 V304I probably damaging Het
Serpina3f G C 12: 104,219,431 E298D probably benign Het
Shoc2 A G 19: 53,988,303 E208G probably benign Het
Sin3a G A 9: 57,096,803 V280I probably benign Het
Slc26a2 A T 18: 61,199,486 I291N probably damaging Het
Slc4a7 T G 14: 14,762,414 D600E probably damaging Het
Slc5a6 A T 5: 31,038,083 F430L possibly damaging Het
Snx19 A C 9: 30,440,157 Q840H probably damaging Het
Spast C A 17: 74,369,216 D340E probably damaging Het
Sprr4 G A 3: 92,500,409 P29S unknown Het
Stk11ip T G 1: 75,527,155 L239R probably damaging Het
Thoc6 A G 17: 23,670,888 L20P probably damaging Het
Tnfrsf8 A T 4: 145,296,877 S129T probably benign Het
Tnrc6c A G 11: 117,742,927 I1284V probably benign Het
Ttn A G 2: 76,710,987 L33885P probably damaging Het
Ttn T C 2: 76,772,507 Y16711C probably damaging Het
Ubn2 T A 6: 38,479,140 C501S probably damaging Het
Ubr1 A T 2: 120,963,442 L87* probably null Het
Uhmk1 T C 1: 170,199,901 Y320C probably damaging Het
Vldlr T C 19: 27,240,547 V465A probably damaging Het
Vmn1r1 C T 1: 182,157,906 A65T probably benign Het
Vmn2r25 C T 6: 123,823,223 C720Y probably damaging Het
Xrra1 T C 7: 99,906,568 Y381H probably benign Het
Zfhx4 T C 3: 5,400,152 L1790P probably benign Het
Zscan4d T A 7: 11,162,667 M259L probably benign Het
Other mutations in Lrp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Lrp8 APN 4 107864076 missense probably benign 0.04
IGL01514:Lrp8 APN 4 107855684 missense probably damaging 1.00
IGL02058:Lrp8 APN 4 107870109 missense probably benign 0.25
IGL02398:Lrp8 APN 4 107847494 missense probably damaging 0.97
IGL02398:Lrp8 APN 4 107869048 missense probably damaging 1.00
IGL02706:Lrp8 APN 4 107803319 nonsense probably null
IGL02754:Lrp8 APN 4 107834755 splice site probably null
IGL02967:Lrp8 APN 4 107861234 missense probably benign 0.21
IGL03080:Lrp8 APN 4 107855799 missense probably damaging 1.00
IGL02837:Lrp8 UTSW 4 107861281 missense probably benign 0.01
R0312:Lrp8 UTSW 4 107806855 intron probably benign
R0440:Lrp8 UTSW 4 107869098 missense probably damaging 0.99
R0598:Lrp8 UTSW 4 107857237 missense possibly damaging 0.73
R1627:Lrp8 UTSW 4 107854416 missense probably damaging 0.99
R1967:Lrp8 UTSW 4 107859971 missense probably damaging 1.00
R2183:Lrp8 UTSW 4 107803265 missense probably damaging 1.00
R2208:Lrp8 UTSW 4 107855790 missense probably damaging 1.00
R2325:Lrp8 UTSW 4 107864009 missense probably benign 0.03
R3712:Lrp8 UTSW 4 107848302 missense probably benign 0.08
R4093:Lrp8 UTSW 4 107843271 nonsense probably null
R4706:Lrp8 UTSW 4 107861273 missense probably benign 0.00
R4840:Lrp8 UTSW 4 107870037 missense possibly damaging 0.79
R4900:Lrp8 UTSW 4 107806809 intron probably benign
R5033:Lrp8 UTSW 4 107834755 splice site probably null
R5280:Lrp8 UTSW 4 107854321 missense probably damaging 1.00
R5381:Lrp8 UTSW 4 107869110 missense probably damaging 1.00
R5935:Lrp8 UTSW 4 107857296 missense probably damaging 1.00
R5972:Lrp8 UTSW 4 107869070 missense probably damaging 1.00
R6076:Lrp8 UTSW 4 107847459 missense possibly damaging 0.81
R6343:Lrp8 UTSW 4 107869156 splice site probably null
R6805:Lrp8 UTSW 4 107854320 missense probably damaging 0.99
R7100:Lrp8 UTSW 4 107802450 missense possibly damaging 0.93
R7262:Lrp8 UTSW 4 107847464 missense probably benign
R7717:Lrp8 UTSW 4 107834743 missense probably benign 0.00
R7949:Lrp8 UTSW 4 107803327 missense probably damaging 1.00
R8371:Lrp8 UTSW 4 107869071 missense probably damaging 1.00
Z1177:Lrp8 UTSW 4 107843332 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGAACTTGTGTCTCTAGGCTCC -3'
(R):5'- TAGGATGTGGACTCAAGGCTG -3'

Sequencing Primer
(F):5'- TGCATTCTCCACTGACACTG -3'
(R):5'- GGACTCAAGGCTGTTTCCCTACAG -3'
Posted On2015-12-21