Mutagenetix > Incidental Mutation

Incidental Mutation 'R4765:Tnfrsf8'

366048

Institutional Source

Beutler Lab

Gene Symbol

Tnfrsf8

Ensembl Gene

ENSMUSG00000028602

Gene Name

tumor necrosis factor receptor superfamily, member 8

Synonyms

CD30

MMRRC Submission

042406-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.056) question?

Stock #

R4765 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

145267137-145315164 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 145296877 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 129 (S129T)

Ref Sequence

ENSEMBL: ENSMUSP00000030339 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030339] [ENSMUST00000123027]

AlphaFold

Q60846

Predicted Effect

probably benign
Transcript: ENSMUST00000030339
AA Change: S129T

PolyPhen 2 Score 0.186 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000030339
Gene: ENSMUSG00000028602
AA Change: S129T

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
TNFR	29	65	2.33e0	SMART
TNFR	69	105	5.51e-7	SMART
TNFR	107	146	2.87e-5	SMART
low complexity region	149	161	N/A	INTRINSIC
transmembrane domain	288	310	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123027
AA Change: S129T

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000118714
Gene: ENSMUSG00000028602
AA Change: S129T

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
TNFR	29	65	2.33e0	SMART
TNFR	69	105	5.51e-7	SMART
TNFR	107	146	2.87e-5	SMART
low complexity region	149	161	N/A	INTRINSIC
low complexity region	293	313	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the TNF-receptor superfamily. This receptor is expressed by activated, but not by resting, T and B cells. TRAF2 and TRAF5 can interact with this receptor, and mediate the signal transduction that leads to the activation of NF-kappaB. This receptor is a positive regulator of apoptosis, and also has been shown to limit the proliferative potential of autoreactive CD8 effector T cells and protect the body against autoimmunity. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display an enlarged thymus, impaired activation-induced death of double-positive thymocytes after CD3 cross-linking, and decreased susceptibility to graft versus host disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	C	T	11: 58,881,161	R490C	probably benign	Het
Abcb11	A	T	2: 69,245,867	F1166I	probably damaging	Het
Acta2	T	C	19: 34,246,152	D181G	probably damaging	Het
Adgrv1	A	G	13: 81,106,919	I6195T	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ankfy1	T	G	11: 72,712,291	S49A	probably benign	Het
Azi2	A	T	9: 118,061,471		probably benign	Het
Bend3	A	T	10: 43,510,750	S380C	probably damaging	Het
Bicc1	T	C	10: 70,940,593	T759A	probably damaging	Het
Cdh10	G	T	15: 19,013,278	V655L	probably damaging	Het
Cdkn2aip	C	A	8: 47,713,547	W75L	probably damaging	Het
Cenpj	G	A	14: 56,549,545	R192*	probably null	Het
Cflar	T	C	1: 58,732,321	S203P	probably damaging	Het
Chd6	A	T	2: 160,966,244	C1683*	probably null	Het
Cpsf2	A	G	12: 101,997,440	Y476C	probably damaging	Het
Cyp4a12a	A	G	4: 115,326,191	D169G	possibly damaging	Het
D430041D05Rik	T	A	2: 104,214,096	R1536S	probably damaging	Het
Depdc5	A	C	5: 32,937,635	D752A	probably damaging	Het
Dnah9	C	T	11: 65,927,726	G78D	probably damaging	Het
Drc1	G	T	5: 30,348,731	Q249H	probably benign	Het
Drg1	T	C	11: 3,250,280	I364V	probably benign	Het
Dtymk	T	C	1: 93,792,909	H130R	probably damaging	Het
Elac2	T	G	11: 64,992,222	F140V	probably damaging	Het
Enpp2	A	G	15: 54,875,672	V353A	possibly damaging	Het
Fat2	T	C	11: 55,281,187	D2900G	probably damaging	Het
Fermt2	G	T	14: 45,462,236	T536K	probably benign	Het
Foxj2	G	T	6: 122,833,271	Q196H	probably benign	Het
Gadl1	A	G	9: 115,966,313	K328R	probably null	Het
Gata6	A	G	18: 11,054,394	T108A	probably benign	Het
Gm16503	G	T	4: 147,541,097	G16V	unknown	Het
Gpr37	T	G	6: 25,669,108	E579A	probably damaging	Het
Gps2	T	C	11: 69,916,361		probably benign	Het
Hcn4	A	T	9: 58,857,977	I581F	unknown	Het
Hfm1	T	A	5: 106,842,539	Y1335F	probably benign	Het
Igsf10	A	T	3: 59,329,705	S1018R	probably benign	Het
Katnal2	C	T	18: 76,977,543		probably null	Het
Kctd8	T	C	5: 69,340,848	K152E	possibly damaging	Het
Lrp8	T	C	4: 107,854,395	C459R	probably damaging	Het
Ly6l	A	T	15: 75,449,694	I48L	probably benign	Het
Megf10	A	T	18: 57,287,794	I835F	possibly damaging	Het
Mei1	A	T	15: 82,112,485	I946F	possibly damaging	Het
Mkl2	C	A	16: 13,412,594	P1048T	probably damaging	Het
Myo7b	G	C	18: 31,961,900	L1881V	probably benign	Het
Nfkbiz	T	C	16: 55,819,024		probably null	Het
Olfr142	T	A	2: 90,252,463	Y175F	probably damaging	Het
Olfr1449	T	C	19: 12,935,076	C113R	possibly damaging	Het
Pcdhgc5	T	C	18: 37,822,069	S799P	probably benign	Het
Plk4	A	G	3: 40,802,022	E97G	probably damaging	Het
Pole2	A	T	12: 69,222,052	H114Q	possibly damaging	Het
Rad9a	C	A	19: 4,200,489	V109L	probably benign	Het
Scn8a	A	G	15: 101,040,471	H1917R	probably benign	Het
Scyl2	C	T	10: 89,659,298	V304I	probably damaging	Het
Serpina3f	G	C	12: 104,219,431	E298D	probably benign	Het
Shoc2	A	G	19: 53,988,303	E208G	probably benign	Het
Sin3a	G	A	9: 57,096,803	V280I	probably benign	Het
Slc26a2	A	T	18: 61,199,486	I291N	probably damaging	Het
Slc4a7	T	G	14: 14,762,414	D600E	probably damaging	Het
Slc5a6	A	T	5: 31,038,083	F430L	possibly damaging	Het
Snx19	A	C	9: 30,440,157	Q840H	probably damaging	Het
Spast	C	A	17: 74,369,216	D340E	probably damaging	Het
Sprr4	G	A	3: 92,500,409	P29S	unknown	Het
Stk11ip	T	G	1: 75,527,155	L239R	probably damaging	Het
Thoc6	A	G	17: 23,670,888	L20P	probably damaging	Het
Tnrc6c	A	G	11: 117,742,927	I1284V	probably benign	Het
Ttn	A	G	2: 76,710,987	L33885P	probably damaging	Het
Ttn	T	C	2: 76,772,507	Y16711C	probably damaging	Het
Ubn2	T	A	6: 38,479,140	C501S	probably damaging	Het
Ubr1	A	T	2: 120,963,442	L87*	probably null	Het
Uhmk1	T	C	1: 170,199,901	Y320C	probably damaging	Het
Vldlr	T	C	19: 27,240,547	V465A	probably damaging	Het
Vmn1r1	C	T	1: 182,157,906	A65T	probably benign	Het
Vmn2r25	C	T	6: 123,823,223	C720Y	probably damaging	Het
Xrra1	T	C	7: 99,906,568	Y381H	probably benign	Het
Zfhx4	T	C	3: 5,400,152	L1790P	probably benign	Het
Zscan4d	T	A	7: 11,162,667	M259L	probably benign	Het

Other mutations in Tnfrsf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Tnfrsf8	APN	4	145292591	splice site	probably null
IGL02815:Tnfrsf8	APN	4	145298778	missense	possibly damaging	0.68
IGL02819:Tnfrsf8	APN	4	145269133	missense	probably damaging	1.00
IGL03033:Tnfrsf8	APN	4	145292649	missense	possibly damaging	0.86
IGL03105:Tnfrsf8	APN	4	145298784	missense	probably damaging	1.00
IGL02837:Tnfrsf8	UTSW	4	145268998	missense	probably benign	0.10
R0114:Tnfrsf8	UTSW	4	145288047	missense	possibly damaging	0.95
R0326:Tnfrsf8	UTSW	4	145288459	missense	possibly damaging	0.64
R0594:Tnfrsf8	UTSW	4	145296861	missense	probably damaging	1.00
R0639:Tnfrsf8	UTSW	4	145288027	missense	probably benign	0.24
R0826:Tnfrsf8	UTSW	4	145285138	splice site	probably benign
R3056:Tnfrsf8	UTSW	4	145285325	critical splice donor site	probably null
R4700:Tnfrsf8	UTSW	4	145303122	missense	probably damaging	0.99
R5149:Tnfrsf8	UTSW	4	145303105	missense	possibly damaging	0.53
R5452:Tnfrsf8	UTSW	4	145292644	missense	possibly damaging	0.96
R5632:Tnfrsf8	UTSW	4	145292633	missense	possibly damaging	0.68
R5673:Tnfrsf8	UTSW	4	145285335	missense	probably benign	0.14
R5877:Tnfrsf8	UTSW	4	145292687	missense	probably benign	0.20
R6243:Tnfrsf8	UTSW	4	145303101	missense	possibly damaging	0.61
R6259:Tnfrsf8	UTSW	4	145277524	critical splice donor site	probably null
R6326:Tnfrsf8	UTSW	4	145269224	missense	probably damaging	1.00
R6603:Tnfrsf8	UTSW	4	145292598	missense	possibly damaging	0.70
R7025:Tnfrsf8	UTSW	4	145274403	missense	possibly damaging	0.87
R7156:Tnfrsf8	UTSW	4	145315084	start codon destroyed	unknown
R7313:Tnfrsf8	UTSW	4	145274382	missense	probably benign	0.33
R7505:Tnfrsf8	UTSW	4	145269115	missense	probably damaging	1.00
R8255:Tnfrsf8	UTSW	4	145315083	start codon destroyed	probably null
R8354:Tnfrsf8	UTSW	4	145287983	missense	probably benign	0.41
R8406:Tnfrsf8	UTSW	4	145292695	missense	probably damaging	0.98
R8454:Tnfrsf8	UTSW	4	145287983	missense	probably benign	0.41
R8554:Tnfrsf8	UTSW	4	145296941	missense	probably damaging	1.00
R8894:Tnfrsf8	UTSW	4	145274468	missense	possibly damaging	0.94
R9125:Tnfrsf8	UTSW	4	145296961	missense	probably damaging	1.00
R9711:Tnfrsf8	UTSW	4	145293098	critical splice donor site	probably null
Z1177:Tnfrsf8	UTSW	4	145292709	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- ACACATCACAGCATGGGGAG -3'
(R):5'- GAGGGTCATGTGGCATCTTACC -3'

Sequencing Primer
(F):5'- GAGAGAAGCTTCGACCTGTTTATCC -3'
(R):5'- TGGATTGTCCCTGTGTACAC -3'

Posted On

2015-12-21