Mutagenetix > Incidental Mutation

Incidental Mutation 'R4765:Snx19'

366065

Institutional Source

Beutler Lab

Gene Symbol

Snx19

Ensembl Gene

ENSMUSG00000031993

Gene Name

sorting nexin 19

Synonyms

3526401K03Rik

MMRRC Submission

042406-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R4765 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30427108-30466733 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 30440157 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 840 (Q840H)

Ref Sequence

ENSEMBL: ENSMUSP00000131895 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164099] [ENSMUST00000216545]

AlphaFold

Q6P4T1

Predicted Effect

probably damaging
Transcript: ENSMUST00000164099
AA Change: Q840H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000131895
Gene: ENSMUSG00000031993
AA Change: Q840H

Domain	Start	End	E-Value	Type
transmembrane domain	29	46	N/A	INTRINSIC
transmembrane domain	51	73	N/A	INTRINSIC
Pfam:PXA	96	269	2.9e-43	PFAM
low complexity region	324	335	N/A	INTRINSIC
low complexity region	371	385	N/A	INTRINSIC
low complexity region	504	528	N/A	INTRINSIC
PX	533	664	1.83e-24	SMART
Pfam:Nexin_C	843	951	1.9e-23	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000216545
AA Change: Q142H

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000216552

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Islet antigen-2 (IA-2) is an autoantigen in type 1 diabetes and plays a role in insulin secretion. IA-2 is found in dense-core secretory vesicles and interacts with the product of this gene, a sorting nexin. In mouse pancreatic beta-cells, the encoded protein influenced insulin secretion by stabilizing the number of dense-core secretory vesicles. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	C	T	11: 58,881,161	R490C	probably benign	Het
Abcb11	A	T	2: 69,245,867	F1166I	probably damaging	Het
Acta2	T	C	19: 34,246,152	D181G	probably damaging	Het
Adgrv1	A	G	13: 81,106,919	I6195T	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ankfy1	T	G	11: 72,712,291	S49A	probably benign	Het
Azi2	A	T	9: 118,061,471		probably benign	Het
Bend3	A	T	10: 43,510,750	S380C	probably damaging	Het
Bicc1	T	C	10: 70,940,593	T759A	probably damaging	Het
Cdh10	G	T	15: 19,013,278	V655L	probably damaging	Het
Cdkn2aip	C	A	8: 47,713,547	W75L	probably damaging	Het
Cenpj	G	A	14: 56,549,545	R192*	probably null	Het
Cflar	T	C	1: 58,732,321	S203P	probably damaging	Het
Chd6	A	T	2: 160,966,244	C1683*	probably null	Het
Cpsf2	A	G	12: 101,997,440	Y476C	probably damaging	Het
Cyp4a12a	A	G	4: 115,326,191	D169G	possibly damaging	Het
D430041D05Rik	T	A	2: 104,214,096	R1536S	probably damaging	Het
Depdc5	A	C	5: 32,937,635	D752A	probably damaging	Het
Dnah9	C	T	11: 65,927,726	G78D	probably damaging	Het
Drc1	G	T	5: 30,348,731	Q249H	probably benign	Het
Drg1	T	C	11: 3,250,280	I364V	probably benign	Het
Dtymk	T	C	1: 93,792,909	H130R	probably damaging	Het
Elac2	T	G	11: 64,992,222	F140V	probably damaging	Het
Enpp2	A	G	15: 54,875,672	V353A	possibly damaging	Het
Fat2	T	C	11: 55,281,187	D2900G	probably damaging	Het
Fermt2	G	T	14: 45,462,236	T536K	probably benign	Het
Foxj2	G	T	6: 122,833,271	Q196H	probably benign	Het
Gadl1	A	G	9: 115,966,313	K328R	probably null	Het
Gata6	A	G	18: 11,054,394	T108A	probably benign	Het
Gm16503	G	T	4: 147,541,097	G16V	unknown	Het
Gpr37	T	G	6: 25,669,108	E579A	probably damaging	Het
Gps2	T	C	11: 69,916,361		probably benign	Het
Hcn4	A	T	9: 58,857,977	I581F	unknown	Het
Hfm1	T	A	5: 106,842,539	Y1335F	probably benign	Het
Igsf10	A	T	3: 59,329,705	S1018R	probably benign	Het
Katnal2	C	T	18: 76,977,543		probably null	Het
Kctd8	T	C	5: 69,340,848	K152E	possibly damaging	Het
Lrp8	T	C	4: 107,854,395	C459R	probably damaging	Het
Ly6l	A	T	15: 75,449,694	I48L	probably benign	Het
Megf10	A	T	18: 57,287,794	I835F	possibly damaging	Het
Mei1	A	T	15: 82,112,485	I946F	possibly damaging	Het
Mkl2	C	A	16: 13,412,594	P1048T	probably damaging	Het
Myo7b	G	C	18: 31,961,900	L1881V	probably benign	Het
Nfkbiz	T	C	16: 55,819,024		probably null	Het
Olfr142	T	A	2: 90,252,463	Y175F	probably damaging	Het
Olfr1449	T	C	19: 12,935,076	C113R	possibly damaging	Het
Pcdhgc5	T	C	18: 37,822,069	S799P	probably benign	Het
Plk4	A	G	3: 40,802,022	E97G	probably damaging	Het
Pole2	A	T	12: 69,222,052	H114Q	possibly damaging	Het
Rad9a	C	A	19: 4,200,489	V109L	probably benign	Het
Scn8a	A	G	15: 101,040,471	H1917R	probably benign	Het
Scyl2	C	T	10: 89,659,298	V304I	probably damaging	Het
Serpina3f	G	C	12: 104,219,431	E298D	probably benign	Het
Shoc2	A	G	19: 53,988,303	E208G	probably benign	Het
Sin3a	G	A	9: 57,096,803	V280I	probably benign	Het
Slc26a2	A	T	18: 61,199,486	I291N	probably damaging	Het
Slc4a7	T	G	14: 14,762,414	D600E	probably damaging	Het
Slc5a6	A	T	5: 31,038,083	F430L	possibly damaging	Het
Spast	C	A	17: 74,369,216	D340E	probably damaging	Het
Sprr4	G	A	3: 92,500,409	P29S	unknown	Het
Stk11ip	T	G	1: 75,527,155	L239R	probably damaging	Het
Thoc6	A	G	17: 23,670,888	L20P	probably damaging	Het
Tnfrsf8	A	T	4: 145,296,877	S129T	probably benign	Het
Tnrc6c	A	G	11: 117,742,927	I1284V	probably benign	Het
Ttn	A	G	2: 76,710,987	L33885P	probably damaging	Het
Ttn	T	C	2: 76,772,507	Y16711C	probably damaging	Het
Ubn2	T	A	6: 38,479,140	C501S	probably damaging	Het
Ubr1	A	T	2: 120,963,442	L87*	probably null	Het
Uhmk1	T	C	1: 170,199,901	Y320C	probably damaging	Het
Vldlr	T	C	19: 27,240,547	V465A	probably damaging	Het
Vmn1r1	C	T	1: 182,157,906	A65T	probably benign	Het
Vmn2r25	C	T	6: 123,823,223	C720Y	probably damaging	Het
Xrra1	T	C	7: 99,906,568	Y381H	probably benign	Het
Zfhx4	T	C	3: 5,400,152	L1790P	probably benign	Het
Zscan4d	T	A	7: 11,162,667	M259L	probably benign	Het

Other mutations in Snx19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Snx19	APN	9	30429084	missense	possibly damaging	0.92
IGL00498:Snx19	APN	9	30428937	missense	possibly damaging	0.92
IGL00718:Snx19	APN	9	30432326	missense	probably damaging	1.00
IGL00902:Snx19	APN	9	30428732	missense	possibly damaging	0.90
IGL01433:Snx19	APN	9	30428771	missense	possibly damaging	0.93
IGL01668:Snx19	APN	9	30427823	missense	probably benign
IGL01732:Snx19	APN	9	30462353	missense	probably damaging	1.00
IGL01767:Snx19	APN	9	30463264	missense	possibly damaging	0.95
IGL02638:Snx19	APN	9	30432364	missense	possibly damaging	0.52
IGL02718:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02719:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02723:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02724:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02725:Snx19	APN	9	30432260	missense	possibly damaging	0.72
IGL02892:Snx19	APN	9	30428364	missense	probably damaging	1.00
IGL03061:Snx19	APN	9	30433632	missense	probably damaging	0.99
IGL03402:Snx19	APN	9	30440134	missense	possibly damaging	0.89
R0125:Snx19	UTSW	9	30440219	missense	probably damaging	1.00
R0133:Snx19	UTSW	9	30428616	missense	possibly damaging	0.94
R0196:Snx19	UTSW	9	30433387	missense	probably damaging	1.00
R0423:Snx19	UTSW	9	30435837	missense	probably damaging	1.00
R0635:Snx19	UTSW	9	30428810	missense	probably damaging	1.00
R0635:Snx19	UTSW	9	30428811	missense	probably damaging	1.00
R1068:Snx19	UTSW	9	30429018	missense	probably damaging	0.99
R1570:Snx19	UTSW	9	30428343	missense	probably damaging	1.00
R1727:Snx19	UTSW	9	30433366	missense	probably damaging	1.00
R1895:Snx19	UTSW	9	30432324	missense	probably damaging	1.00
R1907:Snx19	UTSW	9	30433576	missense	probably damaging	0.99
R1946:Snx19	UTSW	9	30432324	missense	probably damaging	1.00
R1989:Snx19	UTSW	9	30428108	missense	possibly damaging	0.93
R2029:Snx19	UTSW	9	30429000	missense	probably benign	0.01
R2914:Snx19	UTSW	9	30433532	unclassified	probably benign
R3880:Snx19	UTSW	9	30462392	missense	probably damaging	1.00
R4223:Snx19	UTSW	9	30428448	missense	possibly damaging	0.95
R4415:Snx19	UTSW	9	30437483	missense	probably damaging	0.99
R4438:Snx19	UTSW	9	30428599	missense	probably benign	0.01
R4484:Snx19	UTSW	9	30427896	missense	probably benign	0.01
R4585:Snx19	UTSW	9	30440195	missense	probably damaging	1.00
R4771:Snx19	UTSW	9	30433638	missense	probably damaging	1.00
R4922:Snx19	UTSW	9	30437467	missense	probably benign	0.25
R5096:Snx19	UTSW	9	30428786	missense	probably benign	0.40
R5464:Snx19	UTSW	9	30427973	missense	possibly damaging	0.54
R6469:Snx19	UTSW	9	30427743	missense	possibly damaging	0.50
R6886:Snx19	UTSW	9	30428935	missense	probably damaging	1.00
R6988:Snx19	UTSW	9	30428935	missense	probably damaging	1.00
R7131:Snx19	UTSW	9	30427893	missense	probably damaging	1.00
R7268:Snx19	UTSW	9	30440177	missense	probably damaging	1.00
R7772:Snx19	UTSW	9	30428925	missense	probably damaging	0.99
R8087:Snx19	UTSW	9	30464402	missense	probably benign
R8211:Snx19	UTSW	9	30437465	missense	probably benign
R8283:Snx19	UTSW	9	30463226	missense	possibly damaging	0.56
R9000:Snx19	UTSW	9	30464323	missense	unknown
R9383:Snx19	UTSW	9	30435900	missense	probably damaging	1.00
R9436:Snx19	UTSW	9	30463306	missense	possibly damaging	0.55
R9782:Snx19	UTSW	9	30428876	missense	probably benign	0.00
X0019:Snx19	UTSW	9	30437366	missense	probably damaging	1.00
X0024:Snx19	UTSW	9	30427721	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- ATACAGAGCTCATCACCGAGTG -3'
(R):5'- AGGTTGCAGGCTCTTGAAATGC -3'

Sequencing Primer
(F):5'- TCACCGAGTGATAGATACAAGC -3'
(R):5'- GCAGGCTCTTGAAATGCTAATTAAAC -3'

Posted On

2015-12-21