Mutagenetix > Incidental Mutations

Incidental Mutation 'R4765:Bicc1'

366071

Institutional Source

Beutler Lab

Gene Symbol

Bicc1

Ensembl Gene

ENSMUSG00000014329

Gene Name

BicC family RNA binding protein 1

Synonyms

Bic-C, jcpk

MMRRC Submission

042406-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4765 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70922832-71159700 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70940593 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 759 (T759A)

Ref Sequence

ENSEMBL: ENSMUSP00000123201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]

Predicted Effect

probably damaging
Transcript: ENSMUST00000014473
AA Change: T759A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329
AA Change: T759A

Domain	Start	End	E-Value	Type
KH	47	129	2.69e0	SMART
KH	133	206	6.24e-18	SMART
KH	285	355	1.25e-8	SMART
low complexity region	384	402	N/A	INTRINSIC
low complexity region	447	467	N/A	INTRINSIC
low complexity region	480	499	N/A	INTRINSIC
low complexity region	700	718	N/A	INTRINSIC
low complexity region	736	747	N/A	INTRINSIC
low complexity region	794	815	N/A	INTRINSIC
SAM	872	938	2.04e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000131445
AA Change: T677A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329
AA Change: T677A

Domain	Start	End	E-Value	Type
SCOP:d1dtja_	1	46	1e-2	SMART
Blast:KH	1	47	1e-22	BLAST
KH	51	124	6.24e-18	SMART
KH	203	273	1.25e-8	SMART
low complexity region	302	320	N/A	INTRINSIC
low complexity region	365	385	N/A	INTRINSIC
low complexity region	398	417	N/A	INTRINSIC
low complexity region	618	636	N/A	INTRINSIC
low complexity region	654	665	N/A	INTRINSIC
low complexity region	712	733	N/A	INTRINSIC
SAM	790	856	2.04e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000143791
AA Change: T759A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: T759A

Domain	Start	End	E-Value	Type
KH	47	129	2.69e0	SMART
KH	133	206	6.24e-18	SMART
KH	285	355	1.25e-8	SMART
low complexity region	384	402	N/A	INTRINSIC
low complexity region	447	467	N/A	INTRINSIC
low complexity region	480	499	N/A	INTRINSIC
low complexity region	700	718	N/A	INTRINSIC
low complexity region	736	747	N/A	INTRINSIC
low complexity region	794	815	N/A	INTRINSIC
SAM	872	938	4.26e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144740

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	C	T	11: 58,881,161	R490C	probably benign	Het
Abcb11	A	T	2: 69,245,867	F1166I	probably damaging	Het
Acta2	T	C	19: 34,246,152	D181G	probably damaging	Het
Adgrv1	A	G	13: 81,106,919	I6195T	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ankfy1	T	G	11: 72,712,291	S49A	probably benign	Het
Azi2	A	T	9: 118,061,471		probably benign	Het
Bend3	A	T	10: 43,510,750	S380C	probably damaging	Het
Cdh10	G	T	15: 19,013,278	V655L	probably damaging	Het
Cdkn2aip	C	A	8: 47,713,547	W75L	probably damaging	Het
Cenpj	G	A	14: 56,549,545	R192*	probably null	Het
Cflar	T	C	1: 58,732,321	S203P	probably damaging	Het
Chd6	A	T	2: 160,966,244	C1683*	probably null	Het
Cpsf2	A	G	12: 101,997,440	Y476C	probably damaging	Het
Cyp4a12a	A	G	4: 115,326,191	D169G	possibly damaging	Het
D430041D05Rik	T	A	2: 104,214,096	R1536S	probably damaging	Het
Depdc5	A	C	5: 32,937,635	D752A	probably damaging	Het
Dnah9	C	T	11: 65,927,726	G78D	probably damaging	Het
Drc1	G	T	5: 30,348,731	Q249H	probably benign	Het
Drg1	T	C	11: 3,250,280	I364V	probably benign	Het
Dtymk	T	C	1: 93,792,909	H130R	probably damaging	Het
Elac2	T	G	11: 64,992,222	F140V	probably damaging	Het
Enpp2	A	G	15: 54,875,672	V353A	possibly damaging	Het
Fat2	T	C	11: 55,281,187	D2900G	probably damaging	Het
Fermt2	G	T	14: 45,462,236	T536K	probably benign	Het
Foxj2	G	T	6: 122,833,271	Q196H	probably benign	Het
Gadl1	A	G	9: 115,966,313	K328R	probably null	Het
Gata6	A	G	18: 11,054,394	T108A	probably benign	Het
Gm16503	G	T	4: 147,541,097	G16V	unknown	Het
Gpr37	T	G	6: 25,669,108	E579A	probably damaging	Het
Gps2	T	C	11: 69,916,361		probably benign	Het
Hcn4	A	T	9: 58,857,977	I581F	unknown	Het
Hfm1	T	A	5: 106,842,539	Y1335F	probably benign	Het
Igsf10	A	T	3: 59,329,705	S1018R	probably benign	Het
Katnal2	C	T	18: 76,977,543		probably null	Het
Kctd8	T	C	5: 69,340,848	K152E	possibly damaging	Het
Lrp8	T	C	4: 107,854,395	C459R	probably damaging	Het
Ly6l	A	T	15: 75,449,694	I48L	probably benign	Het
Megf10	A	T	18: 57,287,794	I835F	possibly damaging	Het
Mei1	A	T	15: 82,112,485	I946F	possibly damaging	Het
Mkl2	C	A	16: 13,412,594	P1048T	probably damaging	Het
Myo7b	G	C	18: 31,961,900	L1881V	probably benign	Het
Nfkbiz	T	C	16: 55,819,024		probably null	Het
Olfr142	T	A	2: 90,252,463	Y175F	probably damaging	Het
Olfr1449	T	C	19: 12,935,076	C113R	possibly damaging	Het
Pcdhgc5	T	C	18: 37,822,069	S799P	probably benign	Het
Plk4	A	G	3: 40,802,022	E97G	probably damaging	Het
Pole2	A	T	12: 69,222,052	H114Q	possibly damaging	Het
Rad9a	C	A	19: 4,200,489	V109L	probably benign	Het
Scn8a	A	G	15: 101,040,471	H1917R	probably benign	Het
Scyl2	C	T	10: 89,659,298	V304I	probably damaging	Het
Serpina3f	G	C	12: 104,219,431	E298D	probably benign	Het
Shoc2	A	G	19: 53,988,303	E208G	probably benign	Het
Sin3a	G	A	9: 57,096,803	V280I	probably benign	Het
Slc26a2	A	T	18: 61,199,486	I291N	probably damaging	Het
Slc4a7	T	G	14: 14,762,414	D600E	probably damaging	Het
Slc5a6	A	T	5: 31,038,083	F430L	possibly damaging	Het
Snx19	A	C	9: 30,440,157	Q840H	probably damaging	Het
Spast	C	A	17: 74,369,216	D340E	probably damaging	Het
Sprr4	G	A	3: 92,500,409	P29S	unknown	Het
Stk11ip	T	G	1: 75,527,155	L239R	probably damaging	Het
Thoc6	A	G	17: 23,670,888	L20P	probably damaging	Het
Tnfrsf8	A	T	4: 145,296,877	S129T	probably benign	Het
Tnrc6c	A	G	11: 117,742,927	I1284V	probably benign	Het
Ttn	A	G	2: 76,710,987	L33885P	probably damaging	Het
Ttn	T	C	2: 76,772,507	Y16711C	probably damaging	Het
Ubn2	T	A	6: 38,479,140	C501S	probably damaging	Het
Ubr1	A	T	2: 120,963,442	L87*	probably null	Het
Uhmk1	T	C	1: 170,199,901	Y320C	probably damaging	Het
Vldlr	T	C	19: 27,240,547	V465A	probably damaging	Het
Vmn1r1	C	T	1: 182,157,906	A65T	probably benign	Het
Vmn2r25	C	T	6: 123,823,223	C720Y	probably damaging	Het
Xrra1	T	C	7: 99,906,568	Y381H	probably benign	Het
Zfhx4	T	C	3: 5,400,152	L1790P	probably benign	Het
Zscan4d	T	A	7: 11,162,667	M259L	probably benign	Het

Other mutations in Bicc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00961:Bicc1	APN	10	70961157	missense	probably damaging	1.00
IGL01988:Bicc1	APN	10	70956176	missense	probably damaging	1.00
IGL02686:Bicc1	APN	10	70943360	splice site	probably benign
IGL02829:Bicc1	APN	10	70958880	missense	probably damaging	1.00
IGL03276:Bicc1	APN	10	70953438	missense	possibly damaging	0.76
IGL03354:Bicc1	APN	10	70946602	missense	probably benign	0.00
artemis	UTSW	10	71027954	missense	probably damaging	0.99
Pebbles	UTSW	10	70947900	missense	possibly damaging	0.95
PIT1430001:Bicc1	UTSW	10	70957681	missense	possibly damaging	0.94
R0095:Bicc1	UTSW	10	70961158	missense	probably damaging	1.00
R0142:Bicc1	UTSW	10	70925370	missense	probably damaging	1.00
R0184:Bicc1	UTSW	10	71079215	missense	probably benign
R0469:Bicc1	UTSW	10	71079215	missense	probably benign
R0485:Bicc1	UTSW	10	70925315	missense	probably damaging	0.96
R0520:Bicc1	UTSW	10	70957190	missense	probably damaging	0.96
R0884:Bicc1	UTSW	10	70958847	missense	probably damaging	1.00
R1678:Bicc1	UTSW	10	70943518	missense	probably damaging	1.00
R1892:Bicc1	UTSW	10	70958784	missense	probably damaging	1.00
R1943:Bicc1	UTSW	10	71159523	missense	probably damaging	1.00
R2220:Bicc1	UTSW	10	70950125	missense	probably damaging	1.00
R2240:Bicc1	UTSW	10	70946803	critical splice donor site	probably null
R2519:Bicc1	UTSW	10	70930644	missense	probably damaging	1.00
R4362:Bicc1	UTSW	10	70943374	frame shift	probably null
R4363:Bicc1	UTSW	10	70943374	frame shift	probably null
R4419:Bicc1	UTSW	10	70946974	missense	possibly damaging	0.73
R4697:Bicc1	UTSW	10	70953484	missense	possibly damaging	0.87
R4728:Bicc1	UTSW	10	70935831	critical splice donor site	probably null
R4838:Bicc1	UTSW	10	70945316	missense	possibly damaging	0.50
R5022:Bicc1	UTSW	10	70947883	missense	possibly damaging	0.79
R5023:Bicc1	UTSW	10	70947883	missense	possibly damaging	0.79
R5057:Bicc1	UTSW	10	70947883	missense	possibly damaging	0.79
R5082:Bicc1	UTSW	10	70940522	missense	probably benign	0.05
R5160:Bicc1	UTSW	10	70932236	missense	probably damaging	1.00
R5294:Bicc1	UTSW	10	70947900	missense	possibly damaging	0.95
R5639:Bicc1	UTSW	10	70940520	missense	probably damaging	1.00
R5749:Bicc1	UTSW	10	70946969	missense	probably benign	0.00
R6045:Bicc1	UTSW	10	70957081	nonsense	probably null
R6128:Bicc1	UTSW	10	70940483	splice site	probably null
R6277:Bicc1	UTSW	10	71027901	missense	possibly damaging	0.74
R6389:Bicc1	UTSW	10	70958922	missense	probably damaging	1.00
R7021:Bicc1	UTSW	10	70961148	missense	probably damaging	0.99
R7101:Bicc1	UTSW	10	70930653	missense	probably damaging	1.00
R7351:Bicc1	UTSW	10	70947900	missense	probably benign	0.18
R7352:Bicc1	UTSW	10	70947900	missense	probably benign	0.18
R7353:Bicc1	UTSW	10	70947900	missense	probably benign	0.18
R7366:Bicc1	UTSW	10	70943386	missense	probably benign	0.01
R7480:Bicc1	UTSW	10	70943476	missense	probably damaging	1.00
R7541:Bicc1	UTSW	10	70946604	missense	possibly damaging	0.82
R7544:Bicc1	UTSW	10	70956374	missense	possibly damaging	0.89
R7555:Bicc1	UTSW	10	70956291	missense	possibly damaging	0.75
R7663:Bicc1	UTSW	10	70946590	missense	probably benign
R7671:Bicc1	UTSW	10	70957167	missense	probably benign	0.01
R7747:Bicc1	UTSW	10	70946993	missense	probably benign
R8129:Bicc1	UTSW	10	71079203	missense	probably benign	0.01
R8270:Bicc1	UTSW	10	70932108	missense	probably damaging	0.99
R8525:Bicc1	UTSW	10	70943535	missense	possibly damaging	0.67
RF013:Bicc1	UTSW	10	70935830	critical splice donor site	probably null
X0028:Bicc1	UTSW	10	70945336	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGTCTGTCCCTATGACCATAAAG -3'
(R):5'- TAATTAAGGAATCCTGCAGGCC -3'

Sequencing Primer
(F):5'- TGTCCCTATGACCATAAAGAGCCAG -3'
(R):5'- AAGGAATCCTGCAGGCCTTTCC -3'

Posted On

2015-12-21