Mutagenetix > Incidental Mutation

Incidental Mutation 'R4765:Scyl2'

366072

Institutional Source

Beutler Lab

Gene Symbol

Scyl2

Ensembl Gene

ENSMUSG00000069539

Gene Name

SCY1-like 2 (S. cerevisiae)

Synonyms

CVAK104, D10Ertd802e

MMRRC Submission

042406-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.284) question?

Stock #

R4765 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

89638721-89686285 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 89659298 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 304 (V304I)

Ref Sequence

ENSEMBL: ENSMUSP00000133992 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092227] [ENSMUST00000174252] [ENSMUST00000174492]

AlphaFold

Q8CFE4

Predicted Effect

probably damaging
Transcript: ENSMUST00000092227
AA Change: V304I

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000089874
Gene: ENSMUSG00000069539
AA Change: V304I

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	32	324	9.7e-15	PFAM
Pfam:Pkinase	32	327	4.6e-24	PFAM
low complexity region	356	369	N/A	INTRINSIC
low complexity region	679	704	N/A	INTRINSIC
low complexity region	896	921	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000105294

Predicted Effect

probably damaging
Transcript: ENSMUST00000174252
AA Change: V304I

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000133992
Gene: ENSMUSG00000069539
AA Change: V304I

Domain	Start	End	E-Value	Type
Pfam:Pkinase_Tyr	32	324	6.4e-15	PFAM
Pfam:Pkinase	32	327	2.9e-26	PFAM
low complexity region	356	369	N/A	INTRINSIC
low complexity region	680	705	N/A	INTRINSIC
low complexity region	897	922	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000174492
AA Change: V29I

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000134366
Gene: ENSMUSG00000069539
AA Change: V29I

Domain	Start	End	E-Value	Type
SCOP:d1b3ua_	66	259	1e-7	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene associates with clathrin-coated complexes at the plasma membrane and with endocytic coated vesicles. The encoded protein phosphorylates the beta2 subunit of the plasma membrane adapter complex AP2 and interacts with clathrin, showing involvement in clathrin-dependent pathways between the trans-Golgi network and the endosomal system. In addition, this protein has a role in the Wnt signaling pathway by targeting frizzled 5 (Fzd5) for lysosomal degradation. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, absent gastric milk in neonates, postnatal growth retardation, sensory-motor deficits and limb grapsing. Mice homozygous for a conditional allele exhibit similar phenotypes with near complete loss of CA3 neurons. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	C	T	11: 58,881,161	R490C	probably benign	Het
Abcb11	A	T	2: 69,245,867	F1166I	probably damaging	Het
Acta2	T	C	19: 34,246,152	D181G	probably damaging	Het
Adgrv1	A	G	13: 81,106,919	I6195T	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ankfy1	T	G	11: 72,712,291	S49A	probably benign	Het
Azi2	A	T	9: 118,061,471		probably benign	Het
Bend3	A	T	10: 43,510,750	S380C	probably damaging	Het
Bicc1	T	C	10: 70,940,593	T759A	probably damaging	Het
Cdh10	G	T	15: 19,013,278	V655L	probably damaging	Het
Cdkn2aip	C	A	8: 47,713,547	W75L	probably damaging	Het
Cenpj	G	A	14: 56,549,545	R192*	probably null	Het
Cflar	T	C	1: 58,732,321	S203P	probably damaging	Het
Chd6	A	T	2: 160,966,244	C1683*	probably null	Het
Cpsf2	A	G	12: 101,997,440	Y476C	probably damaging	Het
Cyp4a12a	A	G	4: 115,326,191	D169G	possibly damaging	Het
D430041D05Rik	T	A	2: 104,214,096	R1536S	probably damaging	Het
Depdc5	A	C	5: 32,937,635	D752A	probably damaging	Het
Dnah9	C	T	11: 65,927,726	G78D	probably damaging	Het
Drc1	G	T	5: 30,348,731	Q249H	probably benign	Het
Drg1	T	C	11: 3,250,280	I364V	probably benign	Het
Dtymk	T	C	1: 93,792,909	H130R	probably damaging	Het
Elac2	T	G	11: 64,992,222	F140V	probably damaging	Het
Enpp2	A	G	15: 54,875,672	V353A	possibly damaging	Het
Fat2	T	C	11: 55,281,187	D2900G	probably damaging	Het
Fermt2	G	T	14: 45,462,236	T536K	probably benign	Het
Foxj2	G	T	6: 122,833,271	Q196H	probably benign	Het
Gadl1	A	G	9: 115,966,313	K328R	probably null	Het
Gata6	A	G	18: 11,054,394	T108A	probably benign	Het
Gm16503	G	T	4: 147,541,097	G16V	unknown	Het
Gpr37	T	G	6: 25,669,108	E579A	probably damaging	Het
Gps2	T	C	11: 69,916,361		probably benign	Het
Hcn4	A	T	9: 58,857,977	I581F	unknown	Het
Hfm1	T	A	5: 106,842,539	Y1335F	probably benign	Het
Igsf10	A	T	3: 59,329,705	S1018R	probably benign	Het
Katnal2	C	T	18: 76,977,543		probably null	Het
Kctd8	T	C	5: 69,340,848	K152E	possibly damaging	Het
Lrp8	T	C	4: 107,854,395	C459R	probably damaging	Het
Ly6l	A	T	15: 75,449,694	I48L	probably benign	Het
Megf10	A	T	18: 57,287,794	I835F	possibly damaging	Het
Mei1	A	T	15: 82,112,485	I946F	possibly damaging	Het
Mkl2	C	A	16: 13,412,594	P1048T	probably damaging	Het
Myo7b	G	C	18: 31,961,900	L1881V	probably benign	Het
Nfkbiz	T	C	16: 55,819,024		probably null	Het
Olfr142	T	A	2: 90,252,463	Y175F	probably damaging	Het
Olfr1449	T	C	19: 12,935,076	C113R	possibly damaging	Het
Pcdhgc5	T	C	18: 37,822,069	S799P	probably benign	Het
Plk4	A	G	3: 40,802,022	E97G	probably damaging	Het
Pole2	A	T	12: 69,222,052	H114Q	possibly damaging	Het
Rad9a	C	A	19: 4,200,489	V109L	probably benign	Het
Scn8a	A	G	15: 101,040,471	H1917R	probably benign	Het
Serpina3f	G	C	12: 104,219,431	E298D	probably benign	Het
Shoc2	A	G	19: 53,988,303	E208G	probably benign	Het
Sin3a	G	A	9: 57,096,803	V280I	probably benign	Het
Slc26a2	A	T	18: 61,199,486	I291N	probably damaging	Het
Slc4a7	T	G	14: 14,762,414	D600E	probably damaging	Het
Slc5a6	A	T	5: 31,038,083	F430L	possibly damaging	Het
Snx19	A	C	9: 30,440,157	Q840H	probably damaging	Het
Spast	C	A	17: 74,369,216	D340E	probably damaging	Het
Sprr4	G	A	3: 92,500,409	P29S	unknown	Het
Stk11ip	T	G	1: 75,527,155	L239R	probably damaging	Het
Thoc6	A	G	17: 23,670,888	L20P	probably damaging	Het
Tnfrsf8	A	T	4: 145,296,877	S129T	probably benign	Het
Tnrc6c	A	G	11: 117,742,927	I1284V	probably benign	Het
Ttn	A	G	2: 76,710,987	L33885P	probably damaging	Het
Ttn	T	C	2: 76,772,507	Y16711C	probably damaging	Het
Ubn2	T	A	6: 38,479,140	C501S	probably damaging	Het
Ubr1	A	T	2: 120,963,442	L87*	probably null	Het
Uhmk1	T	C	1: 170,199,901	Y320C	probably damaging	Het
Vldlr	T	C	19: 27,240,547	V465A	probably damaging	Het
Vmn1r1	C	T	1: 182,157,906	A65T	probably benign	Het
Vmn2r25	C	T	6: 123,823,223	C720Y	probably damaging	Het
Xrra1	T	C	7: 99,906,568	Y381H	probably benign	Het
Zfhx4	T	C	3: 5,400,152	L1790P	probably benign	Het
Zscan4d	T	A	7: 11,162,667	M259L	probably benign	Het

Other mutations in Scyl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00567:Scyl2	APN	10	89657809	critical splice donor site	probably null
IGL01141:Scyl2	APN	10	89640635	missense	probably benign
IGL01597:Scyl2	APN	10	89652987	missense	probably damaging	0.99
IGL01713:Scyl2	APN	10	89654225	missense	probably damaging	1.00
IGL02349:Scyl2	APN	10	89657938	splice site	probably benign
IGL02466:Scyl2	APN	10	89653009	nonsense	probably null
IGL02511:Scyl2	APN	10	89640819	missense	probably benign
IGL02949:Scyl2	APN	10	89660301	missense	possibly damaging	0.82
IGL03087:Scyl2	APN	10	89652968	missense	possibly damaging	0.93
IGL03117:Scyl2	APN	10	89657867	missense	possibly damaging	0.95
IGL03228:Scyl2	APN	10	89650080	missense	probably damaging	1.00
R0019:Scyl2	UTSW	10	89659321	missense	probably benign	0.44
R0827:Scyl2	UTSW	10	89657865	missense	possibly damaging	0.91
R1394:Scyl2	UTSW	10	89640965	missense	possibly damaging	0.59
R1460:Scyl2	UTSW	10	89657889	missense	possibly damaging	0.90
R1572:Scyl2	UTSW	10	89650956	missense	probably damaging	1.00
R1624:Scyl2	UTSW	10	89640736	missense	probably benign	0.19
R1909:Scyl2	UTSW	10	89640905	missense	probably benign	0.01
R3846:Scyl2	UTSW	10	89640541	missense	probably damaging	1.00
R4041:Scyl2	UTSW	10	89650052	missense	probably damaging	1.00
R4077:Scyl2	UTSW	10	89640596	missense	probably benign	0.01
R4079:Scyl2	UTSW	10	89640596	missense	probably benign	0.01
R4855:Scyl2	UTSW	10	89640463	utr 3 prime	probably benign
R5308:Scyl2	UTSW	10	89642007	missense	probably benign	0.01
R5894:Scyl2	UTSW	10	89640819	missense	probably benign
R5901:Scyl2	UTSW	10	89660262	missense	probably benign	0.03
R6048:Scyl2	UTSW	10	89645486	missense	probably benign	0.33
R6249:Scyl2	UTSW	10	89657857	missense	possibly damaging	0.93
R6658:Scyl2	UTSW	10	89640973	missense	probably benign	0.01
R6827:Scyl2	UTSW	10	89669804	critical splice acceptor site	probably null
R6909:Scyl2	UTSW	10	89645742	missense	probably benign	0.28
R7027:Scyl2	UTSW	10	89645461	critical splice donor site	probably null
R7095:Scyl2	UTSW	10	89669687	missense	probably damaging	1.00
R8062:Scyl2	UTSW	10	89654160	missense	probably damaging	0.97
R8095:Scyl2	UTSW	10	89641103	missense	probably damaging	1.00
R8197:Scyl2	UTSW	10	89662366	missense	probably benign	0.33
R8232:Scyl2	UTSW	10	89662447	missense	probably damaging	1.00
R8241:Scyl2	UTSW	10	89654109	missense	possibly damaging	0.80
R8263:Scyl2	UTSW	10	89640663	missense	possibly damaging	0.50
R9020:Scyl2	UTSW	10	89652996	missense	probably damaging	1.00
R9748:Scyl2	UTSW	10	89640932	missense	probably benign	0.11
Z1177:Scyl2	UTSW	10	89669715	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- CATCCCTGGTTGTGCTATCG -3'
(R):5'- GCTGAGTAGAAAGGGTTCTTAGC -3'

Sequencing Primer
(F):5'- CCCTGGTTGTGCTATCGGGATC -3'
(R):5'- CTGGCTTTGCTCTTTTGAA -3'

Posted On

2015-12-21