Incidental Mutation 'R4765:Gps2'
ID366077
Institutional Source Beutler Lab
Gene Symbol Gps2
Ensembl Gene ENSMUSG00000023170
Gene NameG protein pathway suppressor 2
SynonymsAMF-1
MMRRC Submission 042406-MU
Accession Numbers

Ncbi RefSeq: NM_019726.3; MGI:1891751

Is this an essential gene? Probably essential (E-score: 0.821) question?
Stock #R4765 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69913888-69916591 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 69916361 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043419] [ENSMUST00000057884] [ENSMUST00000061837] [ENSMUST00000070996] [ENSMUST00000071026] [ENSMUST00000072581] [ENSMUST00000108607] [ENSMUST00000108608] [ENSMUST00000108609] [ENSMUST00000108610] [ENSMUST00000108611] [ENSMUST00000108612] [ENSMUST00000134581] [ENSMUST00000133203] [ENSMUST00000177476] [ENSMUST00000108617] [ENSMUST00000152589] [ENSMUST00000177138] [ENSMUST00000116358] [ENSMUST00000153652] [ENSMUST00000108613] [ENSMUST00000164359]
Predicted Effect probably benign
Transcript: ENSMUST00000043419
SMART Domains Protein: ENSMUSP00000047008
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
eIF-5a 83 150 2.43e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000057884
SMART Domains Protein: ENSMUSP00000054072
Gene: ENSMUSG00000023170

DomainStartEndE-ValueType
Pfam:G_path_suppress 5 294 6.1e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061837
SMART Domains Protein: ENSMUSP00000053235
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 913 1043 2.27e-17 SMART
low complexity region 1108 1117 N/A INTRINSIC
NEUZ 1130 1250 4.93e-6 SMART
low complexity region 1453 1464 N/A INTRINSIC
low complexity region 1474 1483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000070996
SMART Domains Protein: ENSMUSP00000067077
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071026
SMART Domains Protein: ENSMUSP00000068651
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072581
SMART Domains Protein: ENSMUSP00000072389
Gene: ENSMUSG00000023170

DomainStartEndE-ValueType
SCOP:d1jjva_ 22 83 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108607
SMART Domains Protein: ENSMUSP00000104247
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108608
SMART Domains Protein: ENSMUSP00000104248
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108609
SMART Domains Protein: ENSMUSP00000104249
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108610
SMART Domains Protein: ENSMUSP00000104250
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108611
SMART Domains Protein: ENSMUSP00000104251
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108612
SMART Domains Protein: ENSMUSP00000104252
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000134581
AA Change: L79P
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124596
Predicted Effect probably benign
Transcript: ENSMUST00000133203
SMART Domains Protein: ENSMUSP00000117917
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
NEUZ 60 185 7.22e-52 SMART
low complexity region 235 246 N/A INTRINSIC
NEUZ 263 387 6.15e-46 SMART
low complexity region 429 443 N/A INTRINSIC
NEUZ 459 583 7.81e-39 SMART
NEUZ 656 786 2.27e-17 SMART
low complexity region 851 860 N/A INTRINSIC
Pfam:Neuralized 875 942 6.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177476
SMART Domains Protein: ENSMUSP00000135185
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 911 1041 2.27e-17 SMART
low complexity region 1106 1115 N/A INTRINSIC
NEUZ 1128 1248 4.93e-6 SMART
low complexity region 1451 1462 N/A INTRINSIC
low complexity region 1472 1481 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108617
SMART Domains Protein: ENSMUSP00000104257
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 3.5e-31 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 2.5e-54 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 2e-48 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 2.6e-41 SMART
NEUZ 891 1021 7.6e-20 SMART
low complexity region 1086 1095 N/A INTRINSIC
NEUZ 1108 1228 1.7e-8 SMART
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1452 1461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152589
SMART Domains Protein: ENSMUSP00000123402
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 2e-39 SMART
Pfam:eIF-5a 83 149 6.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177138
SMART Domains Protein: ENSMUSP00000135277
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 7.22e-52 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 6.15e-46 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 7.81e-39 SMART
NEUZ 889 1019 2.27e-17 SMART
low complexity region 1084 1093 N/A INTRINSIC
NEUZ 1106 1226 4.93e-6 SMART
low complexity region 1429 1440 N/A INTRINSIC
low complexity region 1450 1459 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116358
SMART Domains Protein: ENSMUSP00000112062
Gene: ENSMUSG00000023170

DomainStartEndE-ValueType
SCOP:d1jjva_ 22 83 9e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153652
SMART Domains Protein: ENSMUSP00000137459
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
Pfam:eIF-5a 5 72 1.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132183
SMART Domains Protein: ENSMUSP00000118868
Gene: ENSMUSG00000047284

DomainStartEndE-ValueType
low complexity region 161 172 N/A INTRINSIC
low complexity region 182 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108613
SMART Domains Protein: ENSMUSP00000104253
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164359
SMART Domains Protein: ENSMUSP00000132717
Gene: ENSMUSG00000078812

DomainStartEndE-ValueType
SCOP:d1bkb_1 16 82 4e-39 SMART
Pfam:eIF-5a 83 150 4.8e-27 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in G protein-mitogen-activated protein kinase (MAPK) signaling cascades. When overexpressed in mammalian cells, this gene could potently suppress a RAS- and MAPK-mediated signal and interfere with JNK activity, suggesting that the function of this gene may be signal repression. The encoded protein is an integral subunit of the NCOR1-HDAC3 (nuclear receptor corepressor 1-histone deacetylase 3) complex, and it was shown that the complex inhibits JNK activation through this subunit and thus could potentially provide an alternative mechanism for hormone-mediated antagonism of AP1 (activator protein 1) function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogenesis. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C T 11: 58,881,161 R490C probably benign Het
Abcb11 A T 2: 69,245,867 F1166I probably damaging Het
Acta2 T C 19: 34,246,152 D181G probably damaging Het
Adgrv1 A G 13: 81,106,919 I6195T probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ankfy1 T G 11: 72,712,291 S49A probably benign Het
Azi2 A T 9: 118,061,471 probably benign Het
Bend3 A T 10: 43,510,750 S380C probably damaging Het
Bicc1 T C 10: 70,940,593 T759A probably damaging Het
Cdh10 G T 15: 19,013,278 V655L probably damaging Het
Cdkn2aip C A 8: 47,713,547 W75L probably damaging Het
Cenpj G A 14: 56,549,545 R192* probably null Het
Cflar T C 1: 58,732,321 S203P probably damaging Het
Chd6 A T 2: 160,966,244 C1683* probably null Het
Cpsf2 A G 12: 101,997,440 Y476C probably damaging Het
Cyp4a12a A G 4: 115,326,191 D169G possibly damaging Het
D430041D05Rik T A 2: 104,214,096 R1536S probably damaging Het
Depdc5 A C 5: 32,937,635 D752A probably damaging Het
Dnah9 C T 11: 65,927,726 G78D probably damaging Het
Drc1 G T 5: 30,348,731 Q249H probably benign Het
Drg1 T C 11: 3,250,280 I364V probably benign Het
Dtymk T C 1: 93,792,909 H130R probably damaging Het
Elac2 T G 11: 64,992,222 F140V probably damaging Het
Enpp2 A G 15: 54,875,672 V353A possibly damaging Het
Fat2 T C 11: 55,281,187 D2900G probably damaging Het
Fermt2 G T 14: 45,462,236 T536K probably benign Het
Foxj2 G T 6: 122,833,271 Q196H probably benign Het
Gadl1 A G 9: 115,966,313 K328R probably null Het
Gata6 A G 18: 11,054,394 T108A probably benign Het
Gm16503 G T 4: 147,541,097 G16V unknown Het
Gpr37 T G 6: 25,669,108 E579A probably damaging Het
Hcn4 A T 9: 58,857,977 I581F unknown Het
Hfm1 T A 5: 106,842,539 Y1335F probably benign Het
Igsf10 A T 3: 59,329,705 S1018R probably benign Het
Katnal2 C T 18: 76,977,543 probably null Het
Kctd8 T C 5: 69,340,848 K152E possibly damaging Het
Lrp8 T C 4: 107,854,395 C459R probably damaging Het
Ly6l A T 15: 75,449,694 I48L probably benign Het
Megf10 A T 18: 57,287,794 I835F possibly damaging Het
Mei1 A T 15: 82,112,485 I946F possibly damaging Het
Mkl2 C A 16: 13,412,594 P1048T probably damaging Het
Myo7b G C 18: 31,961,900 L1881V probably benign Het
Nfkbiz T C 16: 55,819,024 probably null Het
Olfr142 T A 2: 90,252,463 Y175F probably damaging Het
Olfr1449 T C 19: 12,935,076 C113R possibly damaging Het
Pcdhgc5 T C 18: 37,822,069 S799P probably benign Het
Plk4 A G 3: 40,802,022 E97G probably damaging Het
Pole2 A T 12: 69,222,052 H114Q possibly damaging Het
Rad9a C A 19: 4,200,489 V109L probably benign Het
Scn8a A G 15: 101,040,471 H1917R probably benign Het
Scyl2 C T 10: 89,659,298 V304I probably damaging Het
Serpina3f G C 12: 104,219,431 E298D probably benign Het
Shoc2 A G 19: 53,988,303 E208G probably benign Het
Sin3a G A 9: 57,096,803 V280I probably benign Het
Slc26a2 A T 18: 61,199,486 I291N probably damaging Het
Slc4a7 T G 14: 14,762,414 D600E probably damaging Het
Slc5a6 A T 5: 31,038,083 F430L possibly damaging Het
Snx19 A C 9: 30,440,157 Q840H probably damaging Het
Spast C A 17: 74,369,216 D340E probably damaging Het
Sprr4 G A 3: 92,500,409 P29S unknown Het
Stk11ip T G 1: 75,527,155 L239R probably damaging Het
Thoc6 A G 17: 23,670,888 L20P probably damaging Het
Tnfrsf8 A T 4: 145,296,877 S129T probably benign Het
Tnrc6c A G 11: 117,742,927 I1284V probably benign Het
Ttn A G 2: 76,710,987 L33885P probably damaging Het
Ttn T C 2: 76,772,507 Y16711C probably damaging Het
Ubn2 T A 6: 38,479,140 C501S probably damaging Het
Ubr1 A T 2: 120,963,442 L87* probably null Het
Uhmk1 T C 1: 170,199,901 Y320C probably damaging Het
Vldlr T C 19: 27,240,547 V465A probably damaging Het
Vmn1r1 C T 1: 182,157,906 A65T probably benign Het
Vmn2r25 C T 6: 123,823,223 C720Y probably damaging Het
Xrra1 T C 7: 99,906,568 Y381H probably benign Het
Zfhx4 T C 3: 5,400,152 L1790P probably benign Het
Zscan4d T A 7: 11,162,667 M259L probably benign Het
Other mutations in Gps2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0067:Gps2 UTSW 11 69914781 nonsense probably null
R0067:Gps2 UTSW 11 69914781 nonsense probably null
R1086:Gps2 UTSW 11 69915224 unclassified probably benign
R1109:Gps2 UTSW 11 69915681 missense possibly damaging 0.94
R1938:Gps2 UTSW 11 69915369 missense probably benign
R1964:Gps2 UTSW 11 69916420 missense probably benign 0.03
R2355:Gps2 UTSW 11 69915381 frame shift probably null
R3773:Gps2 UTSW 11 69916101 missense probably damaging 0.99
R4811:Gps2 UTSW 11 69915928 missense probably damaging 0.99
R5119:Gps2 UTSW 11 69914791 missense probably benign 0.00
R5183:Gps2 UTSW 11 69915197 missense probably benign 0.00
R5218:Gps2 UTSW 11 69916295 critical splice donor site probably null
R5965:Gps2 UTSW 11 69914794 missense possibly damaging 0.60
R7172:Gps2 UTSW 11 69916436 missense probably benign 0.40
R7562:Gps2 UTSW 11 69916482 missense probably benign 0.40
R7854:Gps2 UTSW 11 69915204 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTCCCTTTAAGGTCAGC -3'
(R):5'- TTGGTTTGGGGCACATAAGACC -3'

Sequencing Primer
(F):5'- AAGGTCAGCTTTGTCTCCTAG -3'
(R):5'- ATAAGACCCCAGCCTGAGGG -3'
Posted On2015-12-21